Incidental Mutation 'R9450:Larp1'
ID 714202
Institutional Source Beutler Lab
Gene Symbol Larp1
Ensembl Gene ENSMUSG00000037331
Gene Name La ribonucleoprotein domain family, member 1
Synonyms 1810024J12Rik, 3110040D16Rik, Larp
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 58009064-58062034 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58051064 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 743 (S743P)
Ref Sequence ENSEMBL: ENSMUSP00000071421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071487] [ENSMUST00000178636]
AlphaFold Q6ZQ58
Predicted Effect probably damaging
Transcript: ENSMUST00000071487
AA Change: S743P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071421
Gene: ENSMUSG00000037331
AA Change: S743P

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 37 87 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 304 331 N/A INTRINSIC
LA 376 452 1.98e-40 SMART
low complexity region 538 555 N/A INTRINSIC
low complexity region 562 571 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
low complexity region 758 766 N/A INTRINSIC
DM15 861 902 7.3e-20 SMART
DM15 903 941 3.85e-19 SMART
DM15 942 977 8.59e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178636
AA Change: S743P

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136673
Gene: ENSMUSG00000037331
AA Change: S743P

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 37 87 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 304 331 N/A INTRINSIC
LA 376 452 1.98e-40 SMART
low complexity region 538 555 N/A INTRINSIC
low complexity region 562 571 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
low complexity region 758 766 N/A INTRINSIC
DM15 861 902 7.3e-20 SMART
DM15 903 941 3.85e-19 SMART
DM15 942 977 8.59e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
2810004N23Rik T C 8: 124,840,476 K229E probably damaging Het
4931409K22Rik T A 5: 24,549,449 I395F probably benign Het
9030624J02Rik T C 7: 118,752,895 probably null Het
Abca8b T C 11: 109,969,104 T523A probably damaging Het
Adamts18 G T 8: 113,764,310 D508E probably benign Het
Arap2 T C 5: 62,698,419 E558G probably benign Het
Arid4a A T 12: 71,072,600 D331V Het
Ash1l A T 3: 89,007,832 K1923M possibly damaging Het
Atad2b T A 12: 5,013,859 S947T probably benign Het
B4galt1 A T 4: 40,853,804 M1K probably null Het
BC025446 T A 15: 75,220,725 C98S probably damaging Het
Ccpg1 G A 9: 72,997,421 S4N unknown Het
Cfap43 A T 19: 47,897,871 L102M probably benign Het
Clic6 T C 16: 92,530,756 I483T possibly damaging Het
Col6a6 A T 9: 105,784,174 D245E probably benign Het
Cpsf7 G A 19: 10,540,849 probably null Het
Depdc5 A G 5: 32,934,010 D721G probably benign Het
Dhx29 C T 13: 112,947,328 T639I possibly damaging Het
Dock7 T C 4: 98,973,189 E1397G unknown Het
Dsp C T 13: 38,192,403 T1388M probably damaging Het
Fam186b C T 15: 99,285,544 G73D probably damaging Het
Ganab A G 19: 8,915,712 D960G probably damaging Het
Gm12394 G T 4: 42,793,833 Q100K probably benign Het
Gria1 T C 11: 57,309,789 V764A probably damaging Het
Grk3 T C 5: 112,915,047 K645E probably benign Het
Hecw2 A T 1: 53,839,029 Y1339* probably null Het
Hmcn2 C A 2: 31,426,833 T3808N probably damaging Het
Il20rb A T 9: 100,473,002 N129K possibly damaging Het
Itgb4 T C 11: 115,983,271 Y340H probably damaging Het
Itgb6 T C 2: 60,628,028 I460M probably benign Het
Kat14 T C 2: 144,400,819 I599T possibly damaging Het
Kif1b A C 4: 149,238,010 D817E probably benign Het
Lamb2 T A 9: 108,480,561 C94* probably null Het
Ldlrap1 T C 4: 134,747,179 N267S probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltf T C 9: 111,021,996 L92P probably damaging Het
Mns1 C A 9: 72,452,608 Q347K probably benign Het
Myof A T 19: 37,960,926 F611I probably damaging Het
Nop56 T C 2: 130,275,681 L76P probably damaging Het
Nphp1 T C 2: 127,774,088 H114R Het
Olfr1280 T A 2: 111,316,053 N191K probably benign Het
Olfr1512 G C 14: 52,372,653 Y133* probably null Het
Olfr390 C A 11: 73,787,275 N112K possibly damaging Het
Park2 C A 17: 11,838,634 H301N possibly damaging Het
Pcdha12 A G 18: 37,020,939 D237G probably damaging Het
Pitpnm3 A T 11: 72,061,586 M593K possibly damaging Het
Plxdc1 C T 11: 97,954,855 V211I probably damaging Het
Prpf38a A T 4: 108,572,875 H143Q probably damaging Het
Sdk2 T C 11: 113,806,279 T1769A probably benign Het
Stab1 T C 14: 31,162,939 D153G possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnrc6b T A 15: 80,880,436 M713K probably benign Het
Top2a T C 11: 99,003,608 K966E possibly damaging Het
Vars2 T C 17: 35,662,135 T421A probably damaging Het
Vmn1r1 A T 1: 182,157,205 C298* probably null Het
Vwa3a T C 7: 120,804,030 probably null Het
Vwa5b1 G T 4: 138,588,629 Q601K possibly damaging Het
Zbtb46 T C 2: 181,395,488 K454E probably damaging Het
Zfp426 T C 9: 20,470,281 H470R probably benign Het
Other mutations in Larp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Larp1 APN 11 58042822 missense possibly damaging 0.91
IGL02114:Larp1 APN 11 58057055 missense probably damaging 1.00
IGL03084:Larp1 APN 11 58057095 missense probably damaging 1.00
IGL03126:Larp1 APN 11 58050877 missense possibly damaging 0.65
IGL03278:Larp1 APN 11 58044056 splice site probably benign
Bayou UTSW 11 58058596 frame shift probably null
R0009:Larp1 UTSW 11 58055473 missense possibly damaging 0.94
R0020:Larp1 UTSW 11 58050023 missense probably damaging 1.00
R0479:Larp1 UTSW 11 58042820 missense possibly damaging 0.92
R0845:Larp1 UTSW 11 58047750 missense probably benign 0.00
R1691:Larp1 UTSW 11 58048048 missense probably benign 0.08
R1793:Larp1 UTSW 11 58049938 missense possibly damaging 0.60
R3618:Larp1 UTSW 11 58057346 missense probably benign 0.03
R4689:Larp1 UTSW 11 58041613 missense probably damaging 1.00
R4797:Larp1 UTSW 11 58047980 nonsense probably null
R5089:Larp1 UTSW 11 58047867 missense possibly damaging 0.92
R5309:Larp1 UTSW 11 58050808 missense possibly damaging 0.72
R5883:Larp1 UTSW 11 58042299 missense probably damaging 0.97
R5951:Larp1 UTSW 11 58049939 missense probably benign 0.14
R6038:Larp1 UTSW 11 58041605 missense possibly damaging 0.68
R6038:Larp1 UTSW 11 58041605 missense possibly damaging 0.68
R6266:Larp1 UTSW 11 58042263 missense probably damaging 0.99
R6350:Larp1 UTSW 11 58049831 missense probably benign 0.14
R6650:Larp1 UTSW 11 58058596 frame shift probably null
R6687:Larp1 UTSW 11 58057330 missense probably damaging 0.99
R6736:Larp1 UTSW 11 58042647 splice site probably null
R6881:Larp1 UTSW 11 58050023 missense probably damaging 1.00
R7368:Larp1 UTSW 11 58048078 missense probably damaging 1.00
R7547:Larp1 UTSW 11 58052579 critical splice acceptor site probably null
R7838:Larp1 UTSW 11 58047714 missense possibly damaging 0.82
R8260:Larp1 UTSW 11 58058689 missense probably benign 0.05
R8446:Larp1 UTSW 11 58051209 critical splice donor site probably null
R9381:Larp1 UTSW 11 58058706 missense probably benign
R9466:Larp1 UTSW 11 58052635 missense possibly damaging 0.96
Z1177:Larp1 UTSW 11 58049787 nonsense probably null
Z1186:Larp1 UTSW 11 58042340 missense probably benign 0.00
Z1187:Larp1 UTSW 11 58042340 missense probably benign 0.00
Z1188:Larp1 UTSW 11 58042340 missense probably benign 0.00
Z1189:Larp1 UTSW 11 58042340 missense probably benign 0.00
Z1190:Larp1 UTSW 11 58042340 missense probably benign 0.00
Z1191:Larp1 UTSW 11 58042340 missense probably benign 0.00
Z1192:Larp1 UTSW 11 58042340 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCAACAAGGTGAGGGGAC -3'
(R):5'- TGAGCTCTCAGCCTAAGGATG -3'

Sequencing Primer
(F):5'- GGTGAGGGGACGGGCAC -3'
(R):5'- CCTTTGTTGGCTCAGACCAGG -3'
Posted On 2022-06-15