Incidental Mutation 'R9450:Pitpnm3'
ID 714203
Institutional Source Beutler Lab
Gene Symbol Pitpnm3
Ensembl Gene ENSMUSG00000040543
Gene Name PITPNM family member 3
Synonyms A330068P14Rik, Ackr6
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 71938354-72026604 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71952412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 593 (M593K)
Ref Sequence ENSEMBL: ENSMUSP00000074737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075258] [ENSMUST00000108508]
AlphaFold Q3UHE1
Predicted Effect possibly damaging
Transcript: ENSMUST00000075258
AA Change: M593K

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074737
Gene: ENSMUSG00000040543
AA Change: M593K

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Blast:DDHD 141 361 1e-105 BLAST
DDHD 390 594 1.49e-91 SMART
LNS2 739 870 2.12e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108508
AA Change: M577K

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104148
Gene: ENSMUSG00000040543
AA Change: M577K

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 37 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
Blast:DDHD 125 345 1e-106 BLAST
DDHD 374 578 1.49e-91 SMART
LNS2 723 854 2.12e-55 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
2810004N23Rik T C 8: 125,567,215 (GRCm39) K229E probably damaging Het
Abca8b T C 11: 109,859,930 (GRCm39) T523A probably damaging Het
Adamts18 G T 8: 114,490,942 (GRCm39) D508E probably benign Het
Arap2 T C 5: 62,855,762 (GRCm39) E558G probably benign Het
Arid4a A T 12: 71,119,374 (GRCm39) D331V Het
Ash1l A T 3: 88,915,139 (GRCm39) K1923M possibly damaging Het
Atad2b T A 12: 5,063,859 (GRCm39) S947T probably benign Het
B4galt1 A T 4: 40,853,804 (GRCm39) M1K probably null Het
Ccpg1 G A 9: 72,904,703 (GRCm39) S4N unknown Het
Cfap43 A T 19: 47,886,310 (GRCm39) L102M probably benign Het
Clic6 T C 16: 92,327,644 (GRCm39) I483T possibly damaging Het
Col6a6 A T 9: 105,661,373 (GRCm39) D245E probably benign Het
Cpsf7 G A 19: 10,518,213 (GRCm39) probably null Het
Depdc5 A G 5: 33,091,354 (GRCm39) D721G probably benign Het
Dhx29 C T 13: 113,083,862 (GRCm39) T639I possibly damaging Het
Dock7 T C 4: 98,861,426 (GRCm39) E1397G unknown Het
Dsp C T 13: 38,376,379 (GRCm39) T1388M probably damaging Het
Fam186b C T 15: 99,183,425 (GRCm39) G73D probably damaging Het
Ganab A G 19: 8,893,076 (GRCm39) D960G probably damaging Het
Gria1 T C 11: 57,200,615 (GRCm39) V764A probably damaging Het
Grk3 T C 5: 113,062,913 (GRCm39) K645E probably benign Het
Hecw2 A T 1: 53,878,188 (GRCm39) Y1339* probably null Het
Hmcn2 C A 2: 31,316,845 (GRCm39) T3808N probably damaging Het
Il20rb A T 9: 100,355,055 (GRCm39) N129K possibly damaging Het
Iqca1l T A 5: 24,754,447 (GRCm39) I395F probably benign Het
Itgb4 T C 11: 115,874,097 (GRCm39) Y340H probably damaging Het
Itgb6 T C 2: 60,458,372 (GRCm39) I460M probably benign Het
Kat14 T C 2: 144,242,739 (GRCm39) I599T possibly damaging Het
Kif1b A C 4: 149,322,467 (GRCm39) D817E probably benign Het
Lamb2 T A 9: 108,357,760 (GRCm39) C94* probably null Het
Larp1 T C 11: 57,941,890 (GRCm39) S743P probably damaging Het
Ldlrap1 T C 4: 134,474,490 (GRCm39) N267S probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Ltf T C 9: 110,851,064 (GRCm39) L92P probably damaging Het
Ly6g2 T A 15: 75,092,574 (GRCm39) C98S probably damaging Het
Mns1 C A 9: 72,359,890 (GRCm39) Q347K probably benign Het
Myof A T 19: 37,949,374 (GRCm39) F611I probably damaging Het
Nop56 T C 2: 130,117,601 (GRCm39) L76P probably damaging Het
Nphp1 T C 2: 127,616,008 (GRCm39) H114R Het
Or10g3 G C 14: 52,610,110 (GRCm39) Y133* probably null Het
Or1e30 C A 11: 73,678,101 (GRCm39) N112K possibly damaging Het
Or4k36 T A 2: 111,146,398 (GRCm39) N191K probably benign Het
Pcdha12 A G 18: 37,153,992 (GRCm39) D237G probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Plxdc1 C T 11: 97,845,681 (GRCm39) V211I probably damaging Het
Prkn C A 17: 12,057,521 (GRCm39) H301N possibly damaging Het
Prpf38a A T 4: 108,430,072 (GRCm39) H143Q probably damaging Het
Sdk2 T C 11: 113,697,105 (GRCm39) T1769A probably benign Het
Spata31f1e G T 4: 42,793,833 (GRCm39) Q100K probably benign Het
Stab1 T C 14: 30,884,896 (GRCm39) D153G possibly damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tnrc6b T A 15: 80,764,637 (GRCm39) M713K probably benign Het
Top2a T C 11: 98,894,434 (GRCm39) K966E possibly damaging Het
Vars2 T C 17: 35,973,027 (GRCm39) T421A probably damaging Het
Vmn1r1 A T 1: 181,984,770 (GRCm39) C298* probably null Het
Vps35l T C 7: 118,352,118 (GRCm39) probably null Het
Vwa3a T C 7: 120,403,253 (GRCm39) probably null Het
Vwa5b1 G T 4: 138,315,940 (GRCm39) Q601K possibly damaging Het
Zbtb46 T C 2: 181,037,281 (GRCm39) K454E probably damaging Het
Zfp426 T C 9: 20,381,577 (GRCm39) H470R probably benign Het
Other mutations in Pitpnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:Pitpnm3 APN 11 72,003,077 (GRCm39) splice site probably benign
IGL01871:Pitpnm3 APN 11 71,946,964 (GRCm39) missense probably damaging 0.99
IGL02058:Pitpnm3 APN 11 72,010,965 (GRCm39) missense probably benign 0.31
IGL02267:Pitpnm3 APN 11 71,962,274 (GRCm39) missense probably benign 0.02
IGL02370:Pitpnm3 APN 11 71,942,684 (GRCm39) missense probably benign 0.04
IGL02613:Pitpnm3 APN 11 71,948,898 (GRCm39) missense probably damaging 1.00
IGL02835:Pitpnm3 APN 11 71,952,292 (GRCm39) splice site probably benign
IGL02946:Pitpnm3 APN 11 71,983,378 (GRCm39) missense probably benign 0.08
IGL02989:Pitpnm3 APN 11 72,011,012 (GRCm39) splice site probably benign
IGL03173:Pitpnm3 APN 11 71,983,389 (GRCm39) missense probably benign 0.02
IGL03357:Pitpnm3 APN 11 71,961,716 (GRCm39) nonsense probably null
Frank UTSW 11 71,961,222 (GRCm39) missense probably benign
Mickey UTSW 11 71,961,790 (GRCm39) missense probably damaging 1.00
Stuart UTSW 11 71,942,755 (GRCm39) missense probably null 0.99
R0102:Pitpnm3 UTSW 11 71,947,072 (GRCm39) missense probably damaging 1.00
R0193:Pitpnm3 UTSW 11 71,961,318 (GRCm39) splice site probably benign
R0964:Pitpnm3 UTSW 11 71,949,296 (GRCm39) missense probably damaging 1.00
R1475:Pitpnm3 UTSW 11 71,965,453 (GRCm39) missense probably damaging 1.00
R1566:Pitpnm3 UTSW 11 71,949,785 (GRCm39) splice site probably null
R1951:Pitpnm3 UTSW 11 71,965,450 (GRCm39) missense possibly damaging 0.88
R3915:Pitpnm3 UTSW 11 72,003,110 (GRCm39) missense probably damaging 1.00
R4192:Pitpnm3 UTSW 11 71,942,785 (GRCm39) missense possibly damaging 0.96
R4278:Pitpnm3 UTSW 11 71,965,342 (GRCm39) missense probably damaging 1.00
R4928:Pitpnm3 UTSW 11 71,953,998 (GRCm39) missense probably damaging 1.00
R5543:Pitpnm3 UTSW 11 71,947,023 (GRCm39) missense probably damaging 0.99
R5626:Pitpnm3 UTSW 11 72,003,158 (GRCm39) missense probably benign 0.04
R5635:Pitpnm3 UTSW 11 71,957,986 (GRCm39) missense possibly damaging 0.95
R5958:Pitpnm3 UTSW 11 72,003,193 (GRCm39) splice site probably null
R6531:Pitpnm3 UTSW 11 71,962,313 (GRCm39) missense possibly damaging 0.94
R6634:Pitpnm3 UTSW 11 71,942,755 (GRCm39) missense probably null 0.99
R6764:Pitpnm3 UTSW 11 71,942,059 (GRCm39) missense probably damaging 1.00
R6912:Pitpnm3 UTSW 11 71,961,222 (GRCm39) missense probably benign
R7132:Pitpnm3 UTSW 11 71,942,102 (GRCm39) missense possibly damaging 0.86
R7307:Pitpnm3 UTSW 11 71,961,790 (GRCm39) missense probably damaging 1.00
R7561:Pitpnm3 UTSW 11 71,942,008 (GRCm39) missense probably benign 0.02
R7771:Pitpnm3 UTSW 11 71,952,314 (GRCm39) nonsense probably null
R8099:Pitpnm3 UTSW 11 71,961,144 (GRCm39) missense possibly damaging 0.85
R8753:Pitpnm3 UTSW 11 71,942,704 (GRCm39) missense probably benign 0.01
R8817:Pitpnm3 UTSW 11 71,941,894 (GRCm39) missense possibly damaging 0.74
R8987:Pitpnm3 UTSW 11 72,003,132 (GRCm39) missense probably damaging 1.00
R9054:Pitpnm3 UTSW 11 71,947,017 (GRCm39) missense probably damaging 0.97
R9508:Pitpnm3 UTSW 11 72,003,121 (GRCm39) missense probably damaging 1.00
R9606:Pitpnm3 UTSW 11 71,955,069 (GRCm39) missense probably benign 0.02
R9740:Pitpnm3 UTSW 11 71,947,102 (GRCm39) missense probably benign 0.34
X0018:Pitpnm3 UTSW 11 71,962,266 (GRCm39) missense probably benign 0.42
X0062:Pitpnm3 UTSW 11 71,957,934 (GRCm39) missense probably damaging 1.00
Z1186:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1186:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1187:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1187:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1188:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1188:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1189:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1189:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1190:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1190:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1191:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1191:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Z1192:Pitpnm3 UTSW 11 72,010,969 (GRCm39) missense probably benign
Z1192:Pitpnm3 UTSW 11 71,954,955 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGGAGGCAAGCTCTCTAC -3'
(R):5'- CAACCAAGGGGACAGTTCTCTG -3'

Sequencing Primer
(F):5'- CAGGCAAACCGGAGTTCTTATCTG -3'
(R):5'- CAAGGGGACAGTTCTCTGGTTCC -3'
Posted On 2022-06-15