Incidental Mutation 'R9450:Itgb4'
ID 714209
Institutional Source Beutler Lab
Gene Symbol Itgb4
Ensembl Gene ENSMUSG00000020758
Gene Name integrin beta 4
Synonyms CD104
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 115865556-115899238 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115874097 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 340 (Y340H)
Ref Sequence ENSEMBL: ENSMUSP00000102066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021107] [ENSMUST00000068981] [ENSMUST00000106458] [ENSMUST00000106460] [ENSMUST00000106461] [ENSMUST00000169928]
AlphaFold A2A863
Predicted Effect probably damaging
Transcript: ENSMUST00000021107
AA Change: Y340H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021107
Gene: ENSMUSG00000020758
AA Change: Y340H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068981
AA Change: Y340H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070811
Gene: ENSMUSG00000020758
AA Change: Y340H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1459 1540 1.79e-12 SMART
FN3 1572 1656 1.7e-13 SMART
low complexity region 1689 1702 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106458
AA Change: Y340H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102066
Gene: ENSMUSG00000020758
AA Change: Y340H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106460
AA Change: Y340H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102068
Gene: ENSMUSG00000020758
AA Change: Y340H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1512 1593 1.79e-12 SMART
FN3 1625 1709 1.7e-13 SMART
low complexity region 1742 1755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106461
AA Change: Y340H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102069
Gene: ENSMUSG00000020758
AA Change: Y340H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169928
AA Change: Y340H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127604
Gene: ENSMUSG00000020758
AA Change: Y340H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Integrins are heterodimers comprised of alpha and beta subunits, that are noncovalently associated transmembrane glycoprotein receptors. Different combinations of alpha and beta polypeptides form complexes that vary in their ligand-binding specificities. Integrins mediate cell-matrix or cell-cell adhesion, and transduced signals that regulate gene expression and cell growth. This gene encodes the integrin beta 4 subunit, a receptor for the laminins. This subunit tends to associate with alpha 6 subunit and is likely to play a pivotal role in the biology of invasive carcinoma. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die shortly after birth with extensive detachment of the epidermis and other squamus epithelia. Stratified tissues lack hemidesmosomes and simple epithelia are also defective in adherence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
2810004N23Rik T C 8: 125,567,215 (GRCm39) K229E probably damaging Het
Abca8b T C 11: 109,859,930 (GRCm39) T523A probably damaging Het
Adamts18 G T 8: 114,490,942 (GRCm39) D508E probably benign Het
Arap2 T C 5: 62,855,762 (GRCm39) E558G probably benign Het
Arid4a A T 12: 71,119,374 (GRCm39) D331V Het
Ash1l A T 3: 88,915,139 (GRCm39) K1923M possibly damaging Het
Atad2b T A 12: 5,063,859 (GRCm39) S947T probably benign Het
B4galt1 A T 4: 40,853,804 (GRCm39) M1K probably null Het
Ccpg1 G A 9: 72,904,703 (GRCm39) S4N unknown Het
Cfap43 A T 19: 47,886,310 (GRCm39) L102M probably benign Het
Clic6 T C 16: 92,327,644 (GRCm39) I483T possibly damaging Het
Col6a6 A T 9: 105,661,373 (GRCm39) D245E probably benign Het
Cpsf7 G A 19: 10,518,213 (GRCm39) probably null Het
Depdc5 A G 5: 33,091,354 (GRCm39) D721G probably benign Het
Dhx29 C T 13: 113,083,862 (GRCm39) T639I possibly damaging Het
Dock7 T C 4: 98,861,426 (GRCm39) E1397G unknown Het
Dsp C T 13: 38,376,379 (GRCm39) T1388M probably damaging Het
Fam186b C T 15: 99,183,425 (GRCm39) G73D probably damaging Het
Ganab A G 19: 8,893,076 (GRCm39) D960G probably damaging Het
Gria1 T C 11: 57,200,615 (GRCm39) V764A probably damaging Het
Grk3 T C 5: 113,062,913 (GRCm39) K645E probably benign Het
Hecw2 A T 1: 53,878,188 (GRCm39) Y1339* probably null Het
Hmcn2 C A 2: 31,316,845 (GRCm39) T3808N probably damaging Het
Il20rb A T 9: 100,355,055 (GRCm39) N129K possibly damaging Het
Iqca1l T A 5: 24,754,447 (GRCm39) I395F probably benign Het
Itgb6 T C 2: 60,458,372 (GRCm39) I460M probably benign Het
Kat14 T C 2: 144,242,739 (GRCm39) I599T possibly damaging Het
Kif1b A C 4: 149,322,467 (GRCm39) D817E probably benign Het
Lamb2 T A 9: 108,357,760 (GRCm39) C94* probably null Het
Larp1 T C 11: 57,941,890 (GRCm39) S743P probably damaging Het
Ldlrap1 T C 4: 134,474,490 (GRCm39) N267S probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Ltf T C 9: 110,851,064 (GRCm39) L92P probably damaging Het
Ly6g2 T A 15: 75,092,574 (GRCm39) C98S probably damaging Het
Mns1 C A 9: 72,359,890 (GRCm39) Q347K probably benign Het
Myof A T 19: 37,949,374 (GRCm39) F611I probably damaging Het
Nop56 T C 2: 130,117,601 (GRCm39) L76P probably damaging Het
Nphp1 T C 2: 127,616,008 (GRCm39) H114R Het
Or10g3 G C 14: 52,610,110 (GRCm39) Y133* probably null Het
Or1e30 C A 11: 73,678,101 (GRCm39) N112K possibly damaging Het
Or4k36 T A 2: 111,146,398 (GRCm39) N191K probably benign Het
Pcdha12 A G 18: 37,153,992 (GRCm39) D237G probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Pitpnm3 A T 11: 71,952,412 (GRCm39) M593K possibly damaging Het
Plxdc1 C T 11: 97,845,681 (GRCm39) V211I probably damaging Het
Prkn C A 17: 12,057,521 (GRCm39) H301N possibly damaging Het
Prpf38a A T 4: 108,430,072 (GRCm39) H143Q probably damaging Het
Sdk2 T C 11: 113,697,105 (GRCm39) T1769A probably benign Het
Spata31f1e G T 4: 42,793,833 (GRCm39) Q100K probably benign Het
Stab1 T C 14: 30,884,896 (GRCm39) D153G possibly damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tnrc6b T A 15: 80,764,637 (GRCm39) M713K probably benign Het
Top2a T C 11: 98,894,434 (GRCm39) K966E possibly damaging Het
Vars2 T C 17: 35,973,027 (GRCm39) T421A probably damaging Het
Vmn1r1 A T 1: 181,984,770 (GRCm39) C298* probably null Het
Vps35l T C 7: 118,352,118 (GRCm39) probably null Het
Vwa3a T C 7: 120,403,253 (GRCm39) probably null Het
Vwa5b1 G T 4: 138,315,940 (GRCm39) Q601K possibly damaging Het
Zbtb46 T C 2: 181,037,281 (GRCm39) K454E probably damaging Het
Zfp426 T C 9: 20,381,577 (GRCm39) H470R probably benign Het
Other mutations in Itgb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Itgb4 APN 11 115,881,766 (GRCm39) missense probably damaging 1.00
IGL01391:Itgb4 APN 11 115,881,746 (GRCm39) missense probably damaging 1.00
IGL01431:Itgb4 APN 11 115,897,283 (GRCm39) splice site probably benign
IGL01750:Itgb4 APN 11 115,879,752 (GRCm39) missense probably damaging 0.99
IGL01752:Itgb4 APN 11 115,879,752 (GRCm39) missense probably damaging 0.99
IGL01756:Itgb4 APN 11 115,879,752 (GRCm39) missense probably damaging 0.99
IGL01766:Itgb4 APN 11 115,879,752 (GRCm39) missense probably damaging 0.99
IGL01769:Itgb4 APN 11 115,879,752 (GRCm39) missense probably damaging 0.99
IGL02188:Itgb4 APN 11 115,894,213 (GRCm39) missense probably benign 0.08
IGL02262:Itgb4 APN 11 115,879,752 (GRCm39) missense probably damaging 0.99
IGL02293:Itgb4 APN 11 115,879,752 (GRCm39) missense probably damaging 0.99
IGL02318:Itgb4 APN 11 115,879,752 (GRCm39) missense probably damaging 0.99
IGL02319:Itgb4 APN 11 115,879,752 (GRCm39) missense probably damaging 0.99
IGL02338:Itgb4 APN 11 115,898,795 (GRCm39) missense probably damaging 1.00
IGL02734:Itgb4 APN 11 115,896,792 (GRCm39) missense probably benign
IGL02879:Itgb4 APN 11 115,885,178 (GRCm39) missense probably benign 0.05
IGL02889:Itgb4 APN 11 115,879,731 (GRCm39) missense probably damaging 1.00
IGL03183:Itgb4 APN 11 115,879,550 (GRCm39) missense probably damaging 1.00
IGL03054:Itgb4 UTSW 11 115,891,166 (GRCm39) nonsense probably null
R0021:Itgb4 UTSW 11 115,870,453 (GRCm39) missense possibly damaging 0.95
R0092:Itgb4 UTSW 11 115,869,950 (GRCm39) missense probably damaging 1.00
R0305:Itgb4 UTSW 11 115,870,238 (GRCm39) missense probably damaging 1.00
R0408:Itgb4 UTSW 11 115,898,428 (GRCm39) missense probably damaging 0.99
R0465:Itgb4 UTSW 11 115,870,582 (GRCm39) missense probably damaging 1.00
R0499:Itgb4 UTSW 11 115,870,521 (GRCm39) missense probably benign 0.00
R0535:Itgb4 UTSW 11 115,881,835 (GRCm39) missense possibly damaging 0.86
R0571:Itgb4 UTSW 11 115,870,594 (GRCm39) missense possibly damaging 0.94
R0613:Itgb4 UTSW 11 115,884,168 (GRCm39) missense probably damaging 0.98
R0838:Itgb4 UTSW 11 115,888,988 (GRCm39) intron probably benign
R1381:Itgb4 UTSW 11 115,885,163 (GRCm39) missense probably benign 0.00
R1451:Itgb4 UTSW 11 115,881,710 (GRCm39) missense probably damaging 1.00
R1459:Itgb4 UTSW 11 115,869,937 (GRCm39) missense probably benign 0.42
R1460:Itgb4 UTSW 11 115,874,990 (GRCm39) missense probably damaging 0.96
R1473:Itgb4 UTSW 11 115,874,873 (GRCm39) missense probably benign 0.01
R1484:Itgb4 UTSW 11 115,890,625 (GRCm39) missense probably benign 0.01
R1593:Itgb4 UTSW 11 115,871,817 (GRCm39) missense probably damaging 1.00
R1623:Itgb4 UTSW 11 115,882,142 (GRCm39) nonsense probably null
R1633:Itgb4 UTSW 11 115,898,586 (GRCm39) missense probably damaging 1.00
R1642:Itgb4 UTSW 11 115,898,183 (GRCm39) missense probably damaging 1.00
R1669:Itgb4 UTSW 11 115,882,156 (GRCm39) missense probably benign 0.07
R1713:Itgb4 UTSW 11 115,894,315 (GRCm39) missense probably damaging 1.00
R1732:Itgb4 UTSW 11 115,879,744 (GRCm39) missense probably damaging 1.00
R1791:Itgb4 UTSW 11 115,879,346 (GRCm39) missense probably damaging 1.00
R1847:Itgb4 UTSW 11 115,874,590 (GRCm39) missense probably benign 0.31
R1902:Itgb4 UTSW 11 115,871,564 (GRCm39) missense probably damaging 0.98
R1945:Itgb4 UTSW 11 115,884,279 (GRCm39) nonsense probably null
R2102:Itgb4 UTSW 11 115,896,561 (GRCm39) missense probably benign 0.23
R2184:Itgb4 UTSW 11 115,870,450 (GRCm39) missense probably damaging 0.96
R2334:Itgb4 UTSW 11 115,884,261 (GRCm39) missense probably damaging 1.00
R2401:Itgb4 UTSW 11 115,897,389 (GRCm39) missense possibly damaging 0.67
R3743:Itgb4 UTSW 11 115,894,496 (GRCm39) missense probably damaging 1.00
R3938:Itgb4 UTSW 11 115,896,752 (GRCm39) missense possibly damaging 0.92
R4134:Itgb4 UTSW 11 115,897,296 (GRCm39) missense probably benign 0.03
R4280:Itgb4 UTSW 11 115,881,761 (GRCm39) missense probably damaging 1.00
R4342:Itgb4 UTSW 11 115,879,555 (GRCm39) missense probably benign 0.01
R4434:Itgb4 UTSW 11 115,890,640 (GRCm39) missense probably benign 0.10
R4505:Itgb4 UTSW 11 115,874,087 (GRCm39) splice site silent
R4585:Itgb4 UTSW 11 115,884,151 (GRCm39) missense probably damaging 1.00
R4586:Itgb4 UTSW 11 115,884,151 (GRCm39) missense probably damaging 1.00
R4601:Itgb4 UTSW 11 115,896,548 (GRCm39) missense probably damaging 1.00
R4921:Itgb4 UTSW 11 115,897,431 (GRCm39) missense probably benign 0.12
R4962:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5027:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5029:Itgb4 UTSW 11 115,879,417 (GRCm39) intron probably benign
R5084:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5085:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5124:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5125:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5150:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5175:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5176:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5179:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5207:Itgb4 UTSW 11 115,897,365 (GRCm39) missense probably damaging 1.00
R5263:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5264:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5334:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5337:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5344:Itgb4 UTSW 11 115,880,575 (GRCm39) missense probably null 0.92
R5391:Itgb4 UTSW 11 115,875,894 (GRCm39) missense probably benign 0.05
R5437:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5440:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5653:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5654:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5655:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5772:Itgb4 UTSW 11 115,879,258 (GRCm39) intron probably benign
R5812:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5813:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5814:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5863:Itgb4 UTSW 11 115,881,748 (GRCm39) missense probably damaging 1.00
R5864:Itgb4 UTSW 11 115,881,748 (GRCm39) missense probably damaging 1.00
R5865:Itgb4 UTSW 11 115,881,748 (GRCm39) missense probably damaging 1.00
R5951:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5954:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R5982:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R6043:Itgb4 UTSW 11 115,870,212 (GRCm39) missense probably benign 0.30
R6133:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R6134:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R6135:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R6169:Itgb4 UTSW 11 115,885,102 (GRCm39) missense probably damaging 0.98
R6172:Itgb4 UTSW 11 115,891,237 (GRCm39) missense probably benign 0.23
R6255:Itgb4 UTSW 11 115,888,963 (GRCm39) missense possibly damaging 0.83
R6258:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R6259:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R6260:Itgb4 UTSW 11 115,874,983 (GRCm39) missense probably benign 0.00
R6612:Itgb4 UTSW 11 115,874,897 (GRCm39) missense probably benign 0.00
R7037:Itgb4 UTSW 11 115,896,391 (GRCm39) nonsense probably null
R7371:Itgb4 UTSW 11 115,888,906 (GRCm39) missense probably benign 0.29
R7605:Itgb4 UTSW 11 115,897,302 (GRCm39) missense probably benign 0.01
R7659:Itgb4 UTSW 11 115,870,557 (GRCm39) missense probably damaging 1.00
R7759:Itgb4 UTSW 11 115,894,536 (GRCm39) missense possibly damaging 0.92
R7804:Itgb4 UTSW 11 115,894,510 (GRCm39) missense probably damaging 1.00
R7832:Itgb4 UTSW 11 115,891,087 (GRCm39) missense probably damaging 1.00
R7842:Itgb4 UTSW 11 115,873,531 (GRCm39) missense probably benign 0.18
R7923:Itgb4 UTSW 11 115,873,525 (GRCm39) critical splice acceptor site probably null
R8004:Itgb4 UTSW 11 115,873,531 (GRCm39) missense probably benign 0.00
R8143:Itgb4 UTSW 11 115,884,255 (GRCm39) missense probably damaging 1.00
R8427:Itgb4 UTSW 11 115,882,544 (GRCm39) critical splice donor site probably null
R8857:Itgb4 UTSW 11 115,871,853 (GRCm39) missense probably benign 0.04
R8863:Itgb4 UTSW 11 115,875,898 (GRCm39) nonsense probably null
R8932:Itgb4 UTSW 11 115,879,295 (GRCm39) missense probably benign 0.01
R9153:Itgb4 UTSW 11 115,874,879 (GRCm39) missense probably benign 0.00
R9207:Itgb4 UTSW 11 115,897,923 (GRCm39) missense probably damaging 1.00
R9239:Itgb4 UTSW 11 115,898,130 (GRCm39) missense probably damaging 1.00
R9267:Itgb4 UTSW 11 115,870,465 (GRCm39) missense probably benign
R9289:Itgb4 UTSW 11 115,885,187 (GRCm39) missense probably benign 0.01
R9328:Itgb4 UTSW 11 115,880,625 (GRCm39) missense probably benign 0.00
R9435:Itgb4 UTSW 11 115,895,855 (GRCm39) missense probably benign 0.01
R9649:Itgb4 UTSW 11 115,885,171 (GRCm39) missense possibly damaging 0.78
R9779:Itgb4 UTSW 11 115,882,485 (GRCm39) missense probably damaging 1.00
X0062:Itgb4 UTSW 11 115,884,278 (GRCm39) missense probably damaging 1.00
Z1176:Itgb4 UTSW 11 115,897,346 (GRCm39) missense probably damaging 1.00
Z1177:Itgb4 UTSW 11 115,888,884 (GRCm39) missense probably benign 0.00
Z1177:Itgb4 UTSW 11 115,877,637 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCTGATGGGAAGAACTCCTG -3'
(R):5'- AAGTAGACTCTCAGGCTCCAGG -3'

Sequencing Primer
(F):5'- GGAAGAACTCCTGCCCATC -3'
(R):5'- AGAGACCCCCTTCACTGG -3'
Posted On 2022-06-15