Incidental Mutation 'R9450:Arid4a'
ID 714211
Institutional Source Beutler Lab
Gene Symbol Arid4a
Ensembl Gene ENSMUSG00000048118
Gene Name AT-rich interaction domain 4A
Synonyms A630067N03Rik, Rbbp1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 71062764-71145366 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71119374 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 331 (D331V)
Ref Sequence ENSEMBL: ENSMUSP00000121319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000135709]
AlphaFold F8VPQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000046305
AA Change: D653V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: D653V

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TUDOR 58 114 3.6e-12 SMART
low complexity region 152 167 N/A INTRINSIC
Pfam:RBB1NT 170 262 4e-32 PFAM
ARID 306 397 6.7e-37 SMART
BRIGHT 310 402 2.3e-40 SMART
low complexity region 411 422 N/A INTRINSIC
CHROMO 483 652 6.8e-6 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
coiled coil region 1185 1224 N/A INTRINSIC
low complexity region 1229 1252 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118
AA Change: D331V

DomainStartEndE-ValueType
ARID 1 75 1.02e-16 SMART
BRIGHT 1 80 2.05e-23 SMART
low complexity region 89 100 N/A INTRINSIC
CHROMO 161 330 1.08e-3 SMART
low complexity region 368 385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
2810004N23Rik T C 8: 125,567,215 (GRCm39) K229E probably damaging Het
Abca8b T C 11: 109,859,930 (GRCm39) T523A probably damaging Het
Adamts18 G T 8: 114,490,942 (GRCm39) D508E probably benign Het
Arap2 T C 5: 62,855,762 (GRCm39) E558G probably benign Het
Ash1l A T 3: 88,915,139 (GRCm39) K1923M possibly damaging Het
Atad2b T A 12: 5,063,859 (GRCm39) S947T probably benign Het
B4galt1 A T 4: 40,853,804 (GRCm39) M1K probably null Het
Ccpg1 G A 9: 72,904,703 (GRCm39) S4N unknown Het
Cfap43 A T 19: 47,886,310 (GRCm39) L102M probably benign Het
Clic6 T C 16: 92,327,644 (GRCm39) I483T possibly damaging Het
Col6a6 A T 9: 105,661,373 (GRCm39) D245E probably benign Het
Cpsf7 G A 19: 10,518,213 (GRCm39) probably null Het
Depdc5 A G 5: 33,091,354 (GRCm39) D721G probably benign Het
Dhx29 C T 13: 113,083,862 (GRCm39) T639I possibly damaging Het
Dock7 T C 4: 98,861,426 (GRCm39) E1397G unknown Het
Dsp C T 13: 38,376,379 (GRCm39) T1388M probably damaging Het
Fam186b C T 15: 99,183,425 (GRCm39) G73D probably damaging Het
Ganab A G 19: 8,893,076 (GRCm39) D960G probably damaging Het
Gria1 T C 11: 57,200,615 (GRCm39) V764A probably damaging Het
Grk3 T C 5: 113,062,913 (GRCm39) K645E probably benign Het
Hecw2 A T 1: 53,878,188 (GRCm39) Y1339* probably null Het
Hmcn2 C A 2: 31,316,845 (GRCm39) T3808N probably damaging Het
Il20rb A T 9: 100,355,055 (GRCm39) N129K possibly damaging Het
Iqca1l T A 5: 24,754,447 (GRCm39) I395F probably benign Het
Itgb4 T C 11: 115,874,097 (GRCm39) Y340H probably damaging Het
Itgb6 T C 2: 60,458,372 (GRCm39) I460M probably benign Het
Kat14 T C 2: 144,242,739 (GRCm39) I599T possibly damaging Het
Kif1b A C 4: 149,322,467 (GRCm39) D817E probably benign Het
Lamb2 T A 9: 108,357,760 (GRCm39) C94* probably null Het
Larp1 T C 11: 57,941,890 (GRCm39) S743P probably damaging Het
Ldlrap1 T C 4: 134,474,490 (GRCm39) N267S probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Ltf T C 9: 110,851,064 (GRCm39) L92P probably damaging Het
Ly6g2 T A 15: 75,092,574 (GRCm39) C98S probably damaging Het
Mns1 C A 9: 72,359,890 (GRCm39) Q347K probably benign Het
Myof A T 19: 37,949,374 (GRCm39) F611I probably damaging Het
Nop56 T C 2: 130,117,601 (GRCm39) L76P probably damaging Het
Nphp1 T C 2: 127,616,008 (GRCm39) H114R Het
Or10g3 G C 14: 52,610,110 (GRCm39) Y133* probably null Het
Or1e30 C A 11: 73,678,101 (GRCm39) N112K possibly damaging Het
Or4k36 T A 2: 111,146,398 (GRCm39) N191K probably benign Het
Pcdha12 A G 18: 37,153,992 (GRCm39) D237G probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Pitpnm3 A T 11: 71,952,412 (GRCm39) M593K possibly damaging Het
Plxdc1 C T 11: 97,845,681 (GRCm39) V211I probably damaging Het
Prkn C A 17: 12,057,521 (GRCm39) H301N possibly damaging Het
Prpf38a A T 4: 108,430,072 (GRCm39) H143Q probably damaging Het
Sdk2 T C 11: 113,697,105 (GRCm39) T1769A probably benign Het
Spata31f1e G T 4: 42,793,833 (GRCm39) Q100K probably benign Het
Stab1 T C 14: 30,884,896 (GRCm39) D153G possibly damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tnrc6b T A 15: 80,764,637 (GRCm39) M713K probably benign Het
Top2a T C 11: 98,894,434 (GRCm39) K966E possibly damaging Het
Vars2 T C 17: 35,973,027 (GRCm39) T421A probably damaging Het
Vmn1r1 A T 1: 181,984,770 (GRCm39) C298* probably null Het
Vps35l T C 7: 118,352,118 (GRCm39) probably null Het
Vwa3a T C 7: 120,403,253 (GRCm39) probably null Het
Vwa5b1 G T 4: 138,315,940 (GRCm39) Q601K possibly damaging Het
Zbtb46 T C 2: 181,037,281 (GRCm39) K454E probably damaging Het
Zfp426 T C 9: 20,381,577 (GRCm39) H470R probably benign Het
Other mutations in Arid4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Arid4a APN 12 71,119,367 (GRCm39) missense probably damaging 1.00
IGL00546:Arid4a APN 12 71,122,445 (GRCm39) missense probably benign
IGL00553:Arid4a APN 12 71,122,751 (GRCm39) missense probably benign 0.04
IGL00708:Arid4a APN 12 71,119,502 (GRCm39) missense probably benign 0.02
IGL00847:Arid4a APN 12 71,122,492 (GRCm39) missense probably damaging 1.00
IGL01112:Arid4a APN 12 71,119,507 (GRCm39) critical splice donor site probably null
IGL01456:Arid4a APN 12 71,114,036 (GRCm39) missense probably benign 0.00
IGL01505:Arid4a APN 12 71,083,889 (GRCm39) missense probably damaging 1.00
IGL01555:Arid4a APN 12 71,108,301 (GRCm39) splice site probably benign
IGL01631:Arid4a APN 12 71,069,036 (GRCm39) splice site probably benign
IGL02958:Arid4a APN 12 71,144,337 (GRCm39) missense probably benign 0.01
IGL03087:Arid4a APN 12 71,122,019 (GRCm39) missense possibly damaging 0.94
IGL03111:Arid4a APN 12 71,086,740 (GRCm39) missense probably damaging 1.00
IGL03234:Arid4a APN 12 71,091,834 (GRCm39) missense probably benign 0.34
After_8 UTSW 12 71,070,272 (GRCm39) critical splice acceptor site probably null
ariano UTSW 12 71,116,634 (GRCm39) nonsense probably null
Dusty UTSW 12 71,106,867 (GRCm39) missense probably damaging 1.00
guava UTSW 12 71,119,406 (GRCm39) missense probably damaging 0.99
limoncello UTSW 12 71,114,115 (GRCm39) splice site probably null
Sahara UTSW 12 71,106,889 (GRCm39) nonsense probably null
Under_8 UTSW 12 71,109,980 (GRCm39) missense probably benign 0.10
R0047:Arid4a UTSW 12 71,122,193 (GRCm39) missense probably damaging 1.00
R0047:Arid4a UTSW 12 71,122,193 (GRCm39) missense probably damaging 1.00
R0270:Arid4a UTSW 12 71,119,406 (GRCm39) missense probably damaging 0.99
R0310:Arid4a UTSW 12 71,122,604 (GRCm39) missense probably benign 0.05
R0504:Arid4a UTSW 12 71,093,988 (GRCm39) missense probably damaging 1.00
R1061:Arid4a UTSW 12 71,121,729 (GRCm39) missense probably damaging 1.00
R1087:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1169:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1171:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1531:Arid4a UTSW 12 71,122,779 (GRCm39) missense probably benign 0.01
R1674:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1676:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1768:Arid4a UTSW 12 71,122,112 (GRCm39) missense probably benign 0.01
R1833:Arid4a UTSW 12 71,122,240 (GRCm39) missense possibly damaging 0.50
R1878:Arid4a UTSW 12 71,134,363 (GRCm39) missense probably damaging 1.00
R2290:Arid4a UTSW 12 71,108,315 (GRCm39) missense probably damaging 1.00
R2292:Arid4a UTSW 12 71,108,315 (GRCm39) missense probably damaging 1.00
R2871:Arid4a UTSW 12 71,069,034 (GRCm39) critical splice donor site probably null
R2871:Arid4a UTSW 12 71,069,034 (GRCm39) critical splice donor site probably null
R3411:Arid4a UTSW 12 71,108,299 (GRCm39) splice site probably benign
R3768:Arid4a UTSW 12 71,113,893 (GRCm39) missense probably damaging 1.00
R3838:Arid4a UTSW 12 71,122,559 (GRCm39) missense possibly damaging 0.94
R4320:Arid4a UTSW 12 71,116,769 (GRCm39) missense possibly damaging 0.69
R4589:Arid4a UTSW 12 71,116,738 (GRCm39) missense probably damaging 1.00
R4829:Arid4a UTSW 12 71,070,272 (GRCm39) critical splice acceptor site probably null
R4862:Arid4a UTSW 12 71,122,721 (GRCm39) missense probably damaging 0.96
R4952:Arid4a UTSW 12 71,070,299 (GRCm39) missense possibly damaging 0.64
R5072:Arid4a UTSW 12 71,091,853 (GRCm39) missense probably benign 0.08
R5423:Arid4a UTSW 12 71,116,634 (GRCm39) nonsense probably null
R5767:Arid4a UTSW 12 71,106,867 (GRCm39) missense probably damaging 1.00
R5911:Arid4a UTSW 12 71,116,747 (GRCm39) missense probably damaging 1.00
R5952:Arid4a UTSW 12 71,109,980 (GRCm39) missense probably benign 0.10
R6088:Arid4a UTSW 12 71,069,010 (GRCm39) missense probably damaging 0.99
R6235:Arid4a UTSW 12 71,116,546 (GRCm39) splice site probably null
R6277:Arid4a UTSW 12 71,086,665 (GRCm39) missense possibly damaging 0.49
R6455:Arid4a UTSW 12 71,121,862 (GRCm39) missense probably benign 0.04
R6523:Arid4a UTSW 12 71,114,115 (GRCm39) splice site probably null
R6701:Arid4a UTSW 12 71,134,286 (GRCm39) missense probably damaging 1.00
R6812:Arid4a UTSW 12 71,094,037 (GRCm39) missense possibly damaging 0.92
R6815:Arid4a UTSW 12 71,063,856 (GRCm39) splice site probably null
R6837:Arid4a UTSW 12 71,122,289 (GRCm39) missense probably benign
R6858:Arid4a UTSW 12 71,070,283 (GRCm39) missense probably benign 0.01
R6895:Arid4a UTSW 12 71,110,076 (GRCm39) missense probably benign 0.18
R6901:Arid4a UTSW 12 71,113,911 (GRCm39) missense probably damaging 0.99
R6905:Arid4a UTSW 12 71,108,318 (GRCm39) missense probably benign 0.43
R7387:Arid4a UTSW 12 71,134,270 (GRCm39) missense probably damaging 1.00
R7570:Arid4a UTSW 12 71,109,916 (GRCm39) nonsense probably null
R7772:Arid4a UTSW 12 71,108,363 (GRCm39) missense possibly damaging 0.65
R8194:Arid4a UTSW 12 71,106,889 (GRCm39) nonsense probably null
R8206:Arid4a UTSW 12 71,133,361 (GRCm39) missense probably damaging 1.00
R8552:Arid4a UTSW 12 71,106,849 (GRCm39) missense probably benign
R8696:Arid4a UTSW 12 71,110,090 (GRCm39) missense probably damaging 1.00
R9015:Arid4a UTSW 12 71,122,168 (GRCm39) missense possibly damaging 0.89
R9109:Arid4a UTSW 12 71,122,129 (GRCm39) missense probably damaging 1.00
Z1176:Arid4a UTSW 12 71,086,694 (GRCm39) missense possibly damaging 0.89
Z1177:Arid4a UTSW 12 71,122,411 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATTCCCTCTGCAGGAAATGAGC -3'
(R):5'- ACAGAGGTATGCTGCCTGTC -3'

Sequencing Primer
(F):5'- CCAGGGGGAGTGATTCTATTCAAATG -3'
(R):5'- GCCTGTCACATTGCCATGG -3'
Posted On 2022-06-15