Incidental Mutation 'R9450:Olfr1512'
ID 714216
Institutional Source Beutler Lab
Gene Symbol Olfr1512
Ensembl Gene ENSMUSG00000094140
Gene Name olfactory receptor 1512
Synonyms GA_x6K02T2RJGY-622120-623061, MOR223-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 52371332-52379168 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to C at 52372653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 133 (Y133*)
Ref Sequence ENSEMBL: ENSMUSP00000149717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071221] [ENSMUST00000214980]
AlphaFold Q8VF72
Predicted Effect probably null
Transcript: ENSMUST00000071221
AA Change: Y133*
SMART Domains Protein: ENSMUSP00000071208
Gene: ENSMUSG00000094140
AA Change: Y133*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.1e-48 PFAM
Pfam:7tm_1 41 290 2.9e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214980
AA Change: Y133*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
2810004N23Rik T C 8: 124,840,476 K229E probably damaging Het
4931409K22Rik T A 5: 24,549,449 I395F probably benign Het
9030624J02Rik T C 7: 118,752,895 probably null Het
Abca8b T C 11: 109,969,104 T523A probably damaging Het
Adamts18 G T 8: 113,764,310 D508E probably benign Het
Arap2 T C 5: 62,698,419 E558G probably benign Het
Arid4a A T 12: 71,072,600 D331V Het
Ash1l A T 3: 89,007,832 K1923M possibly damaging Het
Atad2b T A 12: 5,013,859 S947T probably benign Het
B4galt1 A T 4: 40,853,804 M1K probably null Het
BC025446 T A 15: 75,220,725 C98S probably damaging Het
Ccpg1 G A 9: 72,997,421 S4N unknown Het
Cfap43 A T 19: 47,897,871 L102M probably benign Het
Clic6 T C 16: 92,530,756 I483T possibly damaging Het
Col6a6 A T 9: 105,784,174 D245E probably benign Het
Cpsf7 G A 19: 10,540,849 probably null Het
Depdc5 A G 5: 32,934,010 D721G probably benign Het
Dhx29 C T 13: 112,947,328 T639I possibly damaging Het
Dock7 T C 4: 98,973,189 E1397G unknown Het
Dsp C T 13: 38,192,403 T1388M probably damaging Het
Fam186b C T 15: 99,285,544 G73D probably damaging Het
Ganab A G 19: 8,915,712 D960G probably damaging Het
Gm12394 G T 4: 42,793,833 Q100K probably benign Het
Gria1 T C 11: 57,309,789 V764A probably damaging Het
Grk3 T C 5: 112,915,047 K645E probably benign Het
Hecw2 A T 1: 53,839,029 Y1339* probably null Het
Hmcn2 C A 2: 31,426,833 T3808N probably damaging Het
Il20rb A T 9: 100,473,002 N129K possibly damaging Het
Itgb4 T C 11: 115,983,271 Y340H probably damaging Het
Itgb6 T C 2: 60,628,028 I460M probably benign Het
Kat14 T C 2: 144,400,819 I599T possibly damaging Het
Kif1b A C 4: 149,238,010 D817E probably benign Het
Lamb2 T A 9: 108,480,561 C94* probably null Het
Larp1 T C 11: 58,051,064 S743P probably damaging Het
Ldlrap1 T C 4: 134,747,179 N267S probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltf T C 9: 111,021,996 L92P probably damaging Het
Mns1 C A 9: 72,452,608 Q347K probably benign Het
Myof A T 19: 37,960,926 F611I probably damaging Het
Nop56 T C 2: 130,275,681 L76P probably damaging Het
Nphp1 T C 2: 127,774,088 H114R Het
Olfr1280 T A 2: 111,316,053 N191K probably benign Het
Olfr390 C A 11: 73,787,275 N112K possibly damaging Het
Park2 C A 17: 11,838,634 H301N possibly damaging Het
Pcdha12 A G 18: 37,020,939 D237G probably damaging Het
Pitpnm3 A T 11: 72,061,586 M593K possibly damaging Het
Plxdc1 C T 11: 97,954,855 V211I probably damaging Het
Prpf38a A T 4: 108,572,875 H143Q probably damaging Het
Sdk2 T C 11: 113,806,279 T1769A probably benign Het
Stab1 T C 14: 31,162,939 D153G possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnrc6b T A 15: 80,880,436 M713K probably benign Het
Top2a T C 11: 99,003,608 K966E possibly damaging Het
Vars2 T C 17: 35,662,135 T421A probably damaging Het
Vmn1r1 A T 1: 182,157,205 C298* probably null Het
Vwa3a T C 7: 120,804,030 probably null Het
Vwa5b1 G T 4: 138,588,629 Q601K possibly damaging Het
Zbtb46 T C 2: 181,395,488 K454E probably damaging Het
Zfp426 T C 9: 20,470,281 H470R probably benign Het
Other mutations in Olfr1512
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr1512 APN 14 52372510 missense probably damaging 1.00
IGL01375:Olfr1512 APN 14 52372408 missense probably damaging 0.99
IGL02343:Olfr1512 APN 14 52372477 missense probably damaging 1.00
R1443:Olfr1512 UTSW 14 52372951 missense probably damaging 1.00
R1902:Olfr1512 UTSW 14 52372717 missense possibly damaging 0.81
R1903:Olfr1512 UTSW 14 52372717 missense possibly damaging 0.81
R3115:Olfr1512 UTSW 14 52372940 missense probably damaging 1.00
R4752:Olfr1512 UTSW 14 52372307 missense probably damaging 1.00
R5345:Olfr1512 UTSW 14 52372268 nonsense probably null
R5689:Olfr1512 UTSW 14 52372757 missense possibly damaging 0.83
R6185:Olfr1512 UTSW 14 52372562 missense possibly damaging 0.91
R6287:Olfr1512 UTSW 14 52372291 missense probably damaging 1.00
R6757:Olfr1512 UTSW 14 52372715 missense probably damaging 1.00
R8751:Olfr1512 UTSW 14 52372963 missense probably benign 0.03
R8855:Olfr1512 UTSW 14 52372739 missense probably damaging 1.00
R8866:Olfr1512 UTSW 14 52372739 missense probably damaging 1.00
R9038:Olfr1512 UTSW 14 52372259 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCACCAACTCATTGACTGTG -3'
(R):5'- TCTCTCCGTCATCGACATGG -3'

Sequencing Primer
(F):5'- ACTCATTGACTGTGGTATCTGCACAG -3'
(R):5'- GTCATCGACATGGGCATCTC -3'
Posted On 2022-06-15