Incidental Mutation 'R9450:Ly6g2'
ID 714217
Institutional Source Beutler Lab
Gene Symbol Ly6g2
Ensembl Gene ENSMUSG00000047728
Gene Name lymphocyte antigen 6 family member G2
Synonyms BC025446
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 75088227-75094510 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75092574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 98 (C98S)
Ref Sequence ENSEMBL: ENSMUSP00000053396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055719] [ENSMUST00000185307] [ENSMUST00000229521]
AlphaFold A0A087WQT1
Predicted Effect probably damaging
Transcript: ENSMUST00000055719
AA Change: C98S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053396
Gene: ENSMUSG00000047728
AA Change: C98S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.06e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185307
AA Change: C98S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140330
Gene: ENSMUSG00000047728
AA Change: C98S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 5.3e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229521
AA Change: C98S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
2810004N23Rik T C 8: 125,567,215 (GRCm39) K229E probably damaging Het
Abca8b T C 11: 109,859,930 (GRCm39) T523A probably damaging Het
Adamts18 G T 8: 114,490,942 (GRCm39) D508E probably benign Het
Arap2 T C 5: 62,855,762 (GRCm39) E558G probably benign Het
Arid4a A T 12: 71,119,374 (GRCm39) D331V Het
Ash1l A T 3: 88,915,139 (GRCm39) K1923M possibly damaging Het
Atad2b T A 12: 5,063,859 (GRCm39) S947T probably benign Het
B4galt1 A T 4: 40,853,804 (GRCm39) M1K probably null Het
Ccpg1 G A 9: 72,904,703 (GRCm39) S4N unknown Het
Cfap43 A T 19: 47,886,310 (GRCm39) L102M probably benign Het
Clic6 T C 16: 92,327,644 (GRCm39) I483T possibly damaging Het
Col6a6 A T 9: 105,661,373 (GRCm39) D245E probably benign Het
Cpsf7 G A 19: 10,518,213 (GRCm39) probably null Het
Depdc5 A G 5: 33,091,354 (GRCm39) D721G probably benign Het
Dhx29 C T 13: 113,083,862 (GRCm39) T639I possibly damaging Het
Dock7 T C 4: 98,861,426 (GRCm39) E1397G unknown Het
Dsp C T 13: 38,376,379 (GRCm39) T1388M probably damaging Het
Fam186b C T 15: 99,183,425 (GRCm39) G73D probably damaging Het
Ganab A G 19: 8,893,076 (GRCm39) D960G probably damaging Het
Gria1 T C 11: 57,200,615 (GRCm39) V764A probably damaging Het
Grk3 T C 5: 113,062,913 (GRCm39) K645E probably benign Het
Hecw2 A T 1: 53,878,188 (GRCm39) Y1339* probably null Het
Hmcn2 C A 2: 31,316,845 (GRCm39) T3808N probably damaging Het
Il20rb A T 9: 100,355,055 (GRCm39) N129K possibly damaging Het
Iqca1l T A 5: 24,754,447 (GRCm39) I395F probably benign Het
Itgb4 T C 11: 115,874,097 (GRCm39) Y340H probably damaging Het
Itgb6 T C 2: 60,458,372 (GRCm39) I460M probably benign Het
Kat14 T C 2: 144,242,739 (GRCm39) I599T possibly damaging Het
Kif1b A C 4: 149,322,467 (GRCm39) D817E probably benign Het
Lamb2 T A 9: 108,357,760 (GRCm39) C94* probably null Het
Larp1 T C 11: 57,941,890 (GRCm39) S743P probably damaging Het
Ldlrap1 T C 4: 134,474,490 (GRCm39) N267S probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Ltf T C 9: 110,851,064 (GRCm39) L92P probably damaging Het
Mns1 C A 9: 72,359,890 (GRCm39) Q347K probably benign Het
Myof A T 19: 37,949,374 (GRCm39) F611I probably damaging Het
Nop56 T C 2: 130,117,601 (GRCm39) L76P probably damaging Het
Nphp1 T C 2: 127,616,008 (GRCm39) H114R Het
Or10g3 G C 14: 52,610,110 (GRCm39) Y133* probably null Het
Or1e30 C A 11: 73,678,101 (GRCm39) N112K possibly damaging Het
Or4k36 T A 2: 111,146,398 (GRCm39) N191K probably benign Het
Pcdha12 A G 18: 37,153,992 (GRCm39) D237G probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Pitpnm3 A T 11: 71,952,412 (GRCm39) M593K possibly damaging Het
Plxdc1 C T 11: 97,845,681 (GRCm39) V211I probably damaging Het
Prkn C A 17: 12,057,521 (GRCm39) H301N possibly damaging Het
Prpf38a A T 4: 108,430,072 (GRCm39) H143Q probably damaging Het
Sdk2 T C 11: 113,697,105 (GRCm39) T1769A probably benign Het
Spata31f1e G T 4: 42,793,833 (GRCm39) Q100K probably benign Het
Stab1 T C 14: 30,884,896 (GRCm39) D153G possibly damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tnrc6b T A 15: 80,764,637 (GRCm39) M713K probably benign Het
Top2a T C 11: 98,894,434 (GRCm39) K966E possibly damaging Het
Vars2 T C 17: 35,973,027 (GRCm39) T421A probably damaging Het
Vmn1r1 A T 1: 181,984,770 (GRCm39) C298* probably null Het
Vps35l T C 7: 118,352,118 (GRCm39) probably null Het
Vwa3a T C 7: 120,403,253 (GRCm39) probably null Het
Vwa5b1 G T 4: 138,315,940 (GRCm39) Q601K possibly damaging Het
Zbtb46 T C 2: 181,037,281 (GRCm39) K454E probably damaging Het
Zfp426 T C 9: 20,381,577 (GRCm39) H470R probably benign Het
Other mutations in Ly6g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Ly6g2 APN 15 75,093,505 (GRCm39) utr 3 prime probably benign
R0084:Ly6g2 UTSW 15 75,089,624 (GRCm39) missense probably benign 0.01
R0764:Ly6g2 UTSW 15 75,092,572 (GRCm39) missense probably benign
R1736:Ly6g2 UTSW 15 75,089,569 (GRCm39) missense probably damaging 1.00
R1829:Ly6g2 UTSW 15 75,088,605 (GRCm39) critical splice donor site probably null
R5412:Ly6g2 UTSW 15 75,089,669 (GRCm39) missense probably damaging 0.98
R5793:Ly6g2 UTSW 15 75,093,493 (GRCm39) utr 3 prime probably benign
R7434:Ly6g2 UTSW 15 75,088,567 (GRCm39) missense probably benign
R8007:Ly6g2 UTSW 15 75,088,552 (GRCm39) missense probably benign 0.00
R8479:Ly6g2 UTSW 15 75,089,626 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTGGTGGTATATGGCCCAG -3'
(R):5'- GCACCTATACTTCAGGGGCTATAAAG -3'

Sequencing Primer
(F):5'- CCAGACATTGGGATGCTCTG -3'
(R):5'- CTTCAGGGGCTATAAAGTTGAAAC -3'
Posted On 2022-06-15