Incidental Mutation 'R9450:Ganab'
ID 714224
Institutional Source Beutler Lab
Gene Symbol Ganab
Ensembl Gene ENSMUSG00000071650
Gene Name alpha glucosidase 2 alpha neutral subunit
Synonyms G2an, GluII
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.920) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 8875435-8894036 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8893076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 960 (D960G)
Ref Sequence ENSEMBL: ENSMUSP00000093965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096243] [ENSMUST00000096246]
AlphaFold Q8BHN3
Predicted Effect probably benign
Transcript: ENSMUST00000096243
SMART Domains Protein: ENSMUSP00000093962
Gene: ENSMUSG00000071649

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 58 75 N/A INTRINSIC
Pfam:Glyco_transf_43 96 312 1.8e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096246
AA Change: D960G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: D960G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
2810004N23Rik T C 8: 125,567,215 (GRCm39) K229E probably damaging Het
Abca8b T C 11: 109,859,930 (GRCm39) T523A probably damaging Het
Adamts18 G T 8: 114,490,942 (GRCm39) D508E probably benign Het
Arap2 T C 5: 62,855,762 (GRCm39) E558G probably benign Het
Arid4a A T 12: 71,119,374 (GRCm39) D331V Het
Ash1l A T 3: 88,915,139 (GRCm39) K1923M possibly damaging Het
Atad2b T A 12: 5,063,859 (GRCm39) S947T probably benign Het
B4galt1 A T 4: 40,853,804 (GRCm39) M1K probably null Het
Ccpg1 G A 9: 72,904,703 (GRCm39) S4N unknown Het
Cfap43 A T 19: 47,886,310 (GRCm39) L102M probably benign Het
Clic6 T C 16: 92,327,644 (GRCm39) I483T possibly damaging Het
Col6a6 A T 9: 105,661,373 (GRCm39) D245E probably benign Het
Cpsf7 G A 19: 10,518,213 (GRCm39) probably null Het
Depdc5 A G 5: 33,091,354 (GRCm39) D721G probably benign Het
Dhx29 C T 13: 113,083,862 (GRCm39) T639I possibly damaging Het
Dock7 T C 4: 98,861,426 (GRCm39) E1397G unknown Het
Dsp C T 13: 38,376,379 (GRCm39) T1388M probably damaging Het
Fam186b C T 15: 99,183,425 (GRCm39) G73D probably damaging Het
Gria1 T C 11: 57,200,615 (GRCm39) V764A probably damaging Het
Grk3 T C 5: 113,062,913 (GRCm39) K645E probably benign Het
Hecw2 A T 1: 53,878,188 (GRCm39) Y1339* probably null Het
Hmcn2 C A 2: 31,316,845 (GRCm39) T3808N probably damaging Het
Il20rb A T 9: 100,355,055 (GRCm39) N129K possibly damaging Het
Iqca1l T A 5: 24,754,447 (GRCm39) I395F probably benign Het
Itgb4 T C 11: 115,874,097 (GRCm39) Y340H probably damaging Het
Itgb6 T C 2: 60,458,372 (GRCm39) I460M probably benign Het
Kat14 T C 2: 144,242,739 (GRCm39) I599T possibly damaging Het
Kif1b A C 4: 149,322,467 (GRCm39) D817E probably benign Het
Lamb2 T A 9: 108,357,760 (GRCm39) C94* probably null Het
Larp1 T C 11: 57,941,890 (GRCm39) S743P probably damaging Het
Ldlrap1 T C 4: 134,474,490 (GRCm39) N267S probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Ltf T C 9: 110,851,064 (GRCm39) L92P probably damaging Het
Ly6g2 T A 15: 75,092,574 (GRCm39) C98S probably damaging Het
Mns1 C A 9: 72,359,890 (GRCm39) Q347K probably benign Het
Myof A T 19: 37,949,374 (GRCm39) F611I probably damaging Het
Nop56 T C 2: 130,117,601 (GRCm39) L76P probably damaging Het
Nphp1 T C 2: 127,616,008 (GRCm39) H114R Het
Or10g3 G C 14: 52,610,110 (GRCm39) Y133* probably null Het
Or1e30 C A 11: 73,678,101 (GRCm39) N112K possibly damaging Het
Or4k36 T A 2: 111,146,398 (GRCm39) N191K probably benign Het
Pcdha12 A G 18: 37,153,992 (GRCm39) D237G probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Pitpnm3 A T 11: 71,952,412 (GRCm39) M593K possibly damaging Het
Plxdc1 C T 11: 97,845,681 (GRCm39) V211I probably damaging Het
Prkn C A 17: 12,057,521 (GRCm39) H301N possibly damaging Het
Prpf38a A T 4: 108,430,072 (GRCm39) H143Q probably damaging Het
Sdk2 T C 11: 113,697,105 (GRCm39) T1769A probably benign Het
Spata31f1e G T 4: 42,793,833 (GRCm39) Q100K probably benign Het
Stab1 T C 14: 30,884,896 (GRCm39) D153G possibly damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tnrc6b T A 15: 80,764,637 (GRCm39) M713K probably benign Het
Top2a T C 11: 98,894,434 (GRCm39) K966E possibly damaging Het
Vars2 T C 17: 35,973,027 (GRCm39) T421A probably damaging Het
Vmn1r1 A T 1: 181,984,770 (GRCm39) C298* probably null Het
Vps35l T C 7: 118,352,118 (GRCm39) probably null Het
Vwa3a T C 7: 120,403,253 (GRCm39) probably null Het
Vwa5b1 G T 4: 138,315,940 (GRCm39) Q601K possibly damaging Het
Zbtb46 T C 2: 181,037,281 (GRCm39) K454E probably damaging Het
Zfp426 T C 9: 20,381,577 (GRCm39) H470R probably benign Het
Other mutations in Ganab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ganab APN 19 8,879,959 (GRCm39) missense probably benign
IGL00434:Ganab APN 19 8,884,707 (GRCm39) missense probably damaging 1.00
IGL01415:Ganab APN 19 8,892,058 (GRCm39) splice site probably benign
IGL02418:Ganab APN 19 8,888,433 (GRCm39) missense probably null 0.97
IGL02886:Ganab APN 19 8,888,391 (GRCm39) splice site probably benign
IGL02997:Ganab APN 19 8,892,776 (GRCm39) missense probably benign 0.00
IGL03108:Ganab APN 19 8,889,840 (GRCm39) missense probably damaging 1.00
R0240:Ganab UTSW 19 8,890,177 (GRCm39) missense possibly damaging 0.58
R0240:Ganab UTSW 19 8,890,177 (GRCm39) missense possibly damaging 0.58
R0349:Ganab UTSW 19 8,889,016 (GRCm39) missense probably null 0.11
R0457:Ganab UTSW 19 8,884,614 (GRCm39) missense possibly damaging 0.92
R0551:Ganab UTSW 19 8,884,644 (GRCm39) missense probably benign 0.35
R0645:Ganab UTSW 19 8,888,477 (GRCm39) missense probably damaging 1.00
R0652:Ganab UTSW 19 8,892,766 (GRCm39) critical splice acceptor site probably null
R0688:Ganab UTSW 19 8,888,477 (GRCm39) missense probably damaging 1.00
R0726:Ganab UTSW 19 8,888,477 (GRCm39) missense probably damaging 1.00
R1427:Ganab UTSW 19 8,893,030 (GRCm39) missense probably benign 0.00
R1946:Ganab UTSW 19 8,888,172 (GRCm39) missense probably damaging 1.00
R1955:Ganab UTSW 19 8,888,980 (GRCm39) nonsense probably null
R2173:Ganab UTSW 19 8,879,624 (GRCm39) unclassified probably benign
R2280:Ganab UTSW 19 8,886,832 (GRCm39) missense probably damaging 1.00
R2281:Ganab UTSW 19 8,886,832 (GRCm39) missense probably damaging 1.00
R4897:Ganab UTSW 19 8,892,355 (GRCm39) missense probably benign 0.07
R5224:Ganab UTSW 19 8,887,955 (GRCm39) missense probably benign 0.35
R5269:Ganab UTSW 19 8,889,301 (GRCm39) missense probably damaging 1.00
R5323:Ganab UTSW 19 8,886,049 (GRCm39) missense probably benign 0.00
R5850:Ganab UTSW 19 8,889,071 (GRCm39) missense probably damaging 1.00
R6469:Ganab UTSW 19 8,879,996 (GRCm39) critical splice donor site probably null
R6911:Ganab UTSW 19 8,885,152 (GRCm39) splice site probably null
R7284:Ganab UTSW 19 8,889,904 (GRCm39) missense probably damaging 1.00
R7412:Ganab UTSW 19 8,889,892 (GRCm39) missense probably benign 0.01
R7413:Ganab UTSW 19 8,882,339 (GRCm39) missense probably benign 0.01
R7466:Ganab UTSW 19 8,891,933 (GRCm39) nonsense probably null
R7586:Ganab UTSW 19 8,888,716 (GRCm39) missense possibly damaging 0.76
R7657:Ganab UTSW 19 8,884,721 (GRCm39) missense probably damaging 0.99
R7671:Ganab UTSW 19 8,890,216 (GRCm39) missense possibly damaging 0.94
R7729:Ganab UTSW 19 8,892,076 (GRCm39) missense probably benign 0.24
R8223:Ganab UTSW 19 8,888,192 (GRCm39) missense probably damaging 1.00
R8873:Ganab UTSW 19 8,888,243 (GRCm39) nonsense probably null
R9264:Ganab UTSW 19 8,890,228 (GRCm39) missense possibly damaging 0.81
R9388:Ganab UTSW 19 8,892,302 (GRCm39) missense probably damaging 1.00
R9447:Ganab UTSW 19 8,886,894 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAAAGGTTAGTGATAGGTCTG -3'
(R):5'- ATTCAGAGCCCTAGGACAGC -3'

Sequencing Primer
(F):5'- TCTGGCCTTGAAATTGGGAAAAG -3'
(R):5'- AGCCCTGTCATCTTGCCCAG -3'
Posted On 2022-06-15