Incidental Mutation 'R9450:Cpsf7'
ID 714225
Institutional Source Beutler Lab
Gene Symbol Cpsf7
Ensembl Gene ENSMUSG00000034820
Gene Name cleavage and polyadenylation specific factor 7
Synonyms C330017N18Rik, 5730453I16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 10525244-10547735 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 10540849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038379] [ENSMUST00000038379] [ENSMUST00000123788] [ENSMUST00000145210]
AlphaFold Q8BTV2
Predicted Effect probably null
Transcript: ENSMUST00000038379
SMART Domains Protein: ENSMUSP00000038958
Gene: ENSMUSG00000034820

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
RRM 83 158 7.31e-8 SMART
low complexity region 188 202 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 265 291 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 405 439 N/A INTRINSIC
low complexity region 454 471 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000038379
SMART Domains Protein: ENSMUSP00000038958
Gene: ENSMUSG00000034820

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
RRM 83 158 7.31e-8 SMART
low complexity region 188 202 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 265 291 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 405 439 N/A INTRINSIC
low complexity region 454 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123788
SMART Domains Protein: ENSMUSP00000119596
Gene: ENSMUSG00000024667

DomainStartEndE-ValueType
Pfam:Transmemb_17 15 123 9.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145210
SMART Domains Protein: ENSMUSP00000123397
Gene: ENSMUSG00000024667

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 69 2.8e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage factor Im (CFIm) is one of six factors necessary for correct cleavage and polyadenylation of pre-mRNAs. CFIm is composed of three different subunits of 25, 59, and 68 kDa, and it functions as a heterotetramer, with a dimer of the 25 kDa subunit binding to two of the 59 or 68 kDa subunits. The protein encoded by this gene represents the 59 kDa subunit, which can interact with the splicing factor U2 snRNP Auxiliary Factor (U2AF) 65 to link the splicing and polyadenylation complexes. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
2810004N23Rik T C 8: 124,840,476 K229E probably damaging Het
4931409K22Rik T A 5: 24,549,449 I395F probably benign Het
9030624J02Rik T C 7: 118,752,895 probably null Het
Abca8b T C 11: 109,969,104 T523A probably damaging Het
Adamts18 G T 8: 113,764,310 D508E probably benign Het
Arap2 T C 5: 62,698,419 E558G probably benign Het
Arid4a A T 12: 71,072,600 D331V Het
Ash1l A T 3: 89,007,832 K1923M possibly damaging Het
Atad2b T A 12: 5,013,859 S947T probably benign Het
B4galt1 A T 4: 40,853,804 M1K probably null Het
BC025446 T A 15: 75,220,725 C98S probably damaging Het
Ccpg1 G A 9: 72,997,421 S4N unknown Het
Cfap43 A T 19: 47,897,871 L102M probably benign Het
Clic6 T C 16: 92,530,756 I483T possibly damaging Het
Col6a6 A T 9: 105,784,174 D245E probably benign Het
Depdc5 A G 5: 32,934,010 D721G probably benign Het
Dhx29 C T 13: 112,947,328 T639I possibly damaging Het
Dock7 T C 4: 98,973,189 E1397G unknown Het
Dsp C T 13: 38,192,403 T1388M probably damaging Het
Fam186b C T 15: 99,285,544 G73D probably damaging Het
Ganab A G 19: 8,915,712 D960G probably damaging Het
Gm12394 G T 4: 42,793,833 Q100K probably benign Het
Gria1 T C 11: 57,309,789 V764A probably damaging Het
Grk3 T C 5: 112,915,047 K645E probably benign Het
Hecw2 A T 1: 53,839,029 Y1339* probably null Het
Hmcn2 C A 2: 31,426,833 T3808N probably damaging Het
Il20rb A T 9: 100,473,002 N129K possibly damaging Het
Itgb4 T C 11: 115,983,271 Y340H probably damaging Het
Itgb6 T C 2: 60,628,028 I460M probably benign Het
Kat14 T C 2: 144,400,819 I599T possibly damaging Het
Kif1b A C 4: 149,238,010 D817E probably benign Het
Lamb2 T A 9: 108,480,561 C94* probably null Het
Larp1 T C 11: 58,051,064 S743P probably damaging Het
Ldlrap1 T C 4: 134,747,179 N267S probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltf T C 9: 111,021,996 L92P probably damaging Het
Mns1 C A 9: 72,452,608 Q347K probably benign Het
Myof A T 19: 37,960,926 F611I probably damaging Het
Nop56 T C 2: 130,275,681 L76P probably damaging Het
Nphp1 T C 2: 127,774,088 H114R Het
Olfr1280 T A 2: 111,316,053 N191K probably benign Het
Olfr1512 G C 14: 52,372,653 Y133* probably null Het
Olfr390 C A 11: 73,787,275 N112K possibly damaging Het
Park2 C A 17: 11,838,634 H301N possibly damaging Het
Pcdha12 A G 18: 37,020,939 D237G probably damaging Het
Pitpnm3 A T 11: 72,061,586 M593K possibly damaging Het
Plxdc1 C T 11: 97,954,855 V211I probably damaging Het
Prpf38a A T 4: 108,572,875 H143Q probably damaging Het
Sdk2 T C 11: 113,806,279 T1769A probably benign Het
Stab1 T C 14: 31,162,939 D153G possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tnrc6b T A 15: 80,880,436 M713K probably benign Het
Top2a T C 11: 99,003,608 K966E possibly damaging Het
Vars2 T C 17: 35,662,135 T421A probably damaging Het
Vmn1r1 A T 1: 182,157,205 C298* probably null Het
Vwa3a T C 7: 120,804,030 probably null Het
Vwa5b1 G T 4: 138,588,629 Q601K possibly damaging Het
Zbtb46 T C 2: 181,395,488 K454E probably damaging Het
Zfp426 T C 9: 20,470,281 H470R probably benign Het
Other mutations in Cpsf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cpsf7 APN 19 10539787 missense probably damaging 0.98
IGL00870:Cpsf7 APN 19 10539650 splice site probably null
IGL01883:Cpsf7 APN 19 10526023 missense possibly damaging 0.69
IGL02406:Cpsf7 APN 19 10531988 missense probably damaging 0.96
IGL02491:Cpsf7 APN 19 10539637 missense possibly damaging 0.92
IGL02990:Cpsf7 APN 19 10531795 missense probably benign
R0003:Cpsf7 UTSW 19 10539629 missense possibly damaging 0.88
R0540:Cpsf7 UTSW 19 10533318 nonsense probably null
R0633:Cpsf7 UTSW 19 10531782 missense probably benign 0.09
R0662:Cpsf7 UTSW 19 10526008 start codon destroyed probably null 0.77
R1309:Cpsf7 UTSW 19 10533467 critical splice donor site probably null
R1817:Cpsf7 UTSW 19 10535439 missense possibly damaging 0.89
R2004:Cpsf7 UTSW 19 10540709 missense probably damaging 1.00
R2286:Cpsf7 UTSW 19 10535296 missense probably damaging 0.99
R2417:Cpsf7 UTSW 19 10525968 start gained probably benign
R4374:Cpsf7 UTSW 19 10539637 missense probably damaging 1.00
R5788:Cpsf7 UTSW 19 10540718 missense possibly damaging 0.88
R5801:Cpsf7 UTSW 19 10539632 missense probably benign 0.02
R6823:Cpsf7 UTSW 19 10532884 nonsense probably null
R7371:Cpsf7 UTSW 19 10531839 missense probably benign 0.00
R7602:Cpsf7 UTSW 19 10535373 missense probably damaging 0.99
R8185:Cpsf7 UTSW 19 10536860 nonsense probably null
R8935:Cpsf7 UTSW 19 10531981 nonsense probably null
Z1177:Cpsf7 UTSW 19 10535518 missense probably null 0.83
Predicted Primers PCR Primer
(F):5'- GAAAGAATGTGTTGTAGGCCATTG -3'
(R):5'- AGAACTTGAGGGCAGAACATTTC -3'

Sequencing Primer
(F):5'- ATGTTTCTGACAGGAAAAGACATCG -3'
(R):5'- CTTGAGGGCAGAACATTTCTATTAC -3'
Posted On 2022-06-15