Incidental Mutation 'R9450:Cfap43'
ID 714227
Institutional Source Beutler Lab
Gene Symbol Cfap43
Ensembl Gene ENSMUSG00000044948
Gene Name cilia and flagella associated protein 43
Synonyms D19Ertd652e, 4632415N18Rik, Wdr96, 4930428C11Rik, 4930463G05Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R9450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 47723706-47825893 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 47886310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 102 (L102M)
Ref Sequence ENSEMBL: ENSMUSP00000093697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095998]
AlphaFold E9Q7R9
Predicted Effect probably benign
Transcript: ENSMUST00000095998
AA Change: L102M

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093697
Gene: ENSMUSG00000044948
AA Change: L102M

DomainStartEndE-ValueType
SCOP:d1eq1a_ 27 82 3e-3 SMART
low complexity region 115 135 N/A INTRINSIC
Mab-21 194 528 4.37e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
2810004N23Rik T C 8: 125,567,215 (GRCm39) K229E probably damaging Het
Abca8b T C 11: 109,859,930 (GRCm39) T523A probably damaging Het
Adamts18 G T 8: 114,490,942 (GRCm39) D508E probably benign Het
Arap2 T C 5: 62,855,762 (GRCm39) E558G probably benign Het
Arid4a A T 12: 71,119,374 (GRCm39) D331V Het
Ash1l A T 3: 88,915,139 (GRCm39) K1923M possibly damaging Het
Atad2b T A 12: 5,063,859 (GRCm39) S947T probably benign Het
B4galt1 A T 4: 40,853,804 (GRCm39) M1K probably null Het
Ccpg1 G A 9: 72,904,703 (GRCm39) S4N unknown Het
Clic6 T C 16: 92,327,644 (GRCm39) I483T possibly damaging Het
Col6a6 A T 9: 105,661,373 (GRCm39) D245E probably benign Het
Cpsf7 G A 19: 10,518,213 (GRCm39) probably null Het
Depdc5 A G 5: 33,091,354 (GRCm39) D721G probably benign Het
Dhx29 C T 13: 113,083,862 (GRCm39) T639I possibly damaging Het
Dock7 T C 4: 98,861,426 (GRCm39) E1397G unknown Het
Dsp C T 13: 38,376,379 (GRCm39) T1388M probably damaging Het
Fam186b C T 15: 99,183,425 (GRCm39) G73D probably damaging Het
Ganab A G 19: 8,893,076 (GRCm39) D960G probably damaging Het
Gria1 T C 11: 57,200,615 (GRCm39) V764A probably damaging Het
Grk3 T C 5: 113,062,913 (GRCm39) K645E probably benign Het
Hecw2 A T 1: 53,878,188 (GRCm39) Y1339* probably null Het
Hmcn2 C A 2: 31,316,845 (GRCm39) T3808N probably damaging Het
Il20rb A T 9: 100,355,055 (GRCm39) N129K possibly damaging Het
Iqca1l T A 5: 24,754,447 (GRCm39) I395F probably benign Het
Itgb4 T C 11: 115,874,097 (GRCm39) Y340H probably damaging Het
Itgb6 T C 2: 60,458,372 (GRCm39) I460M probably benign Het
Kat14 T C 2: 144,242,739 (GRCm39) I599T possibly damaging Het
Kif1b A C 4: 149,322,467 (GRCm39) D817E probably benign Het
Lamb2 T A 9: 108,357,760 (GRCm39) C94* probably null Het
Larp1 T C 11: 57,941,890 (GRCm39) S743P probably damaging Het
Ldlrap1 T C 4: 134,474,490 (GRCm39) N267S probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Ltf T C 9: 110,851,064 (GRCm39) L92P probably damaging Het
Ly6g2 T A 15: 75,092,574 (GRCm39) C98S probably damaging Het
Mns1 C A 9: 72,359,890 (GRCm39) Q347K probably benign Het
Myof A T 19: 37,949,374 (GRCm39) F611I probably damaging Het
Nop56 T C 2: 130,117,601 (GRCm39) L76P probably damaging Het
Nphp1 T C 2: 127,616,008 (GRCm39) H114R Het
Or10g3 G C 14: 52,610,110 (GRCm39) Y133* probably null Het
Or1e30 C A 11: 73,678,101 (GRCm39) N112K possibly damaging Het
Or4k36 T A 2: 111,146,398 (GRCm39) N191K probably benign Het
Pcdha12 A G 18: 37,153,992 (GRCm39) D237G probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Pitpnm3 A T 11: 71,952,412 (GRCm39) M593K possibly damaging Het
Plxdc1 C T 11: 97,845,681 (GRCm39) V211I probably damaging Het
Prkn C A 17: 12,057,521 (GRCm39) H301N possibly damaging Het
Prpf38a A T 4: 108,430,072 (GRCm39) H143Q probably damaging Het
Sdk2 T C 11: 113,697,105 (GRCm39) T1769A probably benign Het
Spata31f1e G T 4: 42,793,833 (GRCm39) Q100K probably benign Het
Stab1 T C 14: 30,884,896 (GRCm39) D153G possibly damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tnrc6b T A 15: 80,764,637 (GRCm39) M713K probably benign Het
Top2a T C 11: 98,894,434 (GRCm39) K966E possibly damaging Het
Vars2 T C 17: 35,973,027 (GRCm39) T421A probably damaging Het
Vmn1r1 A T 1: 181,984,770 (GRCm39) C298* probably null Het
Vps35l T C 7: 118,352,118 (GRCm39) probably null Het
Vwa3a T C 7: 120,403,253 (GRCm39) probably null Het
Vwa5b1 G T 4: 138,315,940 (GRCm39) Q601K possibly damaging Het
Zbtb46 T C 2: 181,037,281 (GRCm39) K454E probably damaging Het
Zfp426 T C 9: 20,381,577 (GRCm39) H470R probably benign Het
Other mutations in Cfap43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cfap43 APN 19 47,818,914 (GRCm39) missense probably benign 0.08
IGL00325:Cfap43 APN 19 47,811,627 (GRCm39) splice site probably benign
IGL00918:Cfap43 APN 19 47,885,100 (GRCm39) missense probably damaging 1.00
IGL01402:Cfap43 APN 19 47,784,105 (GRCm39) missense probably benign 0.25
IGL01404:Cfap43 APN 19 47,784,105 (GRCm39) missense probably benign 0.25
IGL01656:Cfap43 APN 19 47,740,339 (GRCm39) missense possibly damaging 0.95
IGL01738:Cfap43 APN 19 47,785,624 (GRCm39) missense probably damaging 0.97
IGL02168:Cfap43 APN 19 47,740,362 (GRCm39) splice site probably benign
IGL02225:Cfap43 APN 19 47,800,616 (GRCm39) missense probably benign 0.00
IGL02308:Cfap43 APN 19 47,736,463 (GRCm39) missense probably benign
IGL02354:Cfap43 APN 19 47,885,852 (GRCm39) nonsense probably null
IGL02361:Cfap43 APN 19 47,885,852 (GRCm39) nonsense probably null
IGL03283:Cfap43 APN 19 47,779,851 (GRCm39) splice site probably benign
3-1:Cfap43 UTSW 19 47,740,294 (GRCm39) missense probably benign 0.02
IGL03046:Cfap43 UTSW 19 47,804,302 (GRCm39) missense probably damaging 1.00
PIT4495001:Cfap43 UTSW 19 47,885,741 (GRCm39) missense probably damaging 1.00
R0270:Cfap43 UTSW 19 47,785,642 (GRCm39) splice site probably benign
R0421:Cfap43 UTSW 19 47,824,014 (GRCm39) missense probably benign 0.00
R0433:Cfap43 UTSW 19 47,814,210 (GRCm39) missense probably benign 0.44
R0576:Cfap43 UTSW 19 47,785,579 (GRCm39) missense probably benign 0.00
R0646:Cfap43 UTSW 19 47,752,115 (GRCm39) missense probably benign 0.25
R0740:Cfap43 UTSW 19 47,824,243 (GRCm39) missense possibly damaging 0.95
R0836:Cfap43 UTSW 19 47,804,285 (GRCm39) missense probably benign 0.02
R0899:Cfap43 UTSW 19 47,736,433 (GRCm39) missense possibly damaging 0.93
R1171:Cfap43 UTSW 19 47,824,150 (GRCm39) missense probably benign 0.03
R1271:Cfap43 UTSW 19 47,736,387 (GRCm39) missense probably damaging 0.98
R1271:Cfap43 UTSW 19 47,728,183 (GRCm39) missense probably benign 0.22
R1371:Cfap43 UTSW 19 47,824,045 (GRCm39) missense possibly damaging 0.95
R1469:Cfap43 UTSW 19 47,885,314 (GRCm39) missense probably damaging 1.00
R1541:Cfap43 UTSW 19 47,752,291 (GRCm39) splice site probably null
R1625:Cfap43 UTSW 19 47,739,527 (GRCm39) missense probably damaging 1.00
R1679:Cfap43 UTSW 19 47,761,553 (GRCm39) missense probably benign 0.00
R1690:Cfap43 UTSW 19 47,739,505 (GRCm39) critical splice donor site probably null
R1820:Cfap43 UTSW 19 47,885,655 (GRCm39) missense probably damaging 0.99
R1891:Cfap43 UTSW 19 47,802,380 (GRCm39) missense probably damaging 0.97
R1956:Cfap43 UTSW 19 47,885,649 (GRCm39) missense probably benign 0.19
R1958:Cfap43 UTSW 19 47,885,649 (GRCm39) missense probably benign 0.19
R2110:Cfap43 UTSW 19 47,824,197 (GRCm39) missense probably damaging 1.00
R2118:Cfap43 UTSW 19 47,758,877 (GRCm39) missense probably damaging 1.00
R2290:Cfap43 UTSW 19 47,761,574 (GRCm39) missense probably damaging 0.99
R3691:Cfap43 UTSW 19 47,885,512 (GRCm39) missense probably benign 0.01
R3765:Cfap43 UTSW 19 47,824,014 (GRCm39) missense probably benign 0.01
R3917:Cfap43 UTSW 19 47,886,189 (GRCm39) missense probably benign 0.00
R3924:Cfap43 UTSW 19 47,785,555 (GRCm39) missense probably benign 0.00
R3925:Cfap43 UTSW 19 47,785,555 (GRCm39) missense probably benign 0.00
R3947:Cfap43 UTSW 19 47,754,418 (GRCm39) missense probably benign 0.28
R4256:Cfap43 UTSW 19 47,770,844 (GRCm39) missense probably benign 0.06
R4385:Cfap43 UTSW 19 47,785,568 (GRCm39) missense probably benign 0.28
R4395:Cfap43 UTSW 19 47,740,352 (GRCm39) missense probably benign 0.00
R4405:Cfap43 UTSW 19 47,728,236 (GRCm39) missense possibly damaging 0.57
R4541:Cfap43 UTSW 19 47,736,454 (GRCm39) missense probably benign 0.02
R4583:Cfap43 UTSW 19 47,825,655 (GRCm39) missense probably null 0.99
R4690:Cfap43 UTSW 19 47,736,298 (GRCm39) missense probably benign 0.45
R4852:Cfap43 UTSW 19 47,885,550 (GRCm39) missense possibly damaging 0.87
R5185:Cfap43 UTSW 19 47,768,833 (GRCm39) missense probably benign 0.00
R5192:Cfap43 UTSW 19 47,814,364 (GRCm39) missense probably damaging 1.00
R5196:Cfap43 UTSW 19 47,814,364 (GRCm39) missense probably damaging 1.00
R5197:Cfap43 UTSW 19 47,885,811 (GRCm39) missense probably damaging 1.00
R5205:Cfap43 UTSW 19 47,885,987 (GRCm39) missense possibly damaging 0.76
R5425:Cfap43 UTSW 19 47,885,371 (GRCm39) missense possibly damaging 0.94
R5516:Cfap43 UTSW 19 47,726,648 (GRCm39) splice site probably null
R5644:Cfap43 UTSW 19 47,784,114 (GRCm39) missense possibly damaging 0.66
R5844:Cfap43 UTSW 19 47,784,135 (GRCm39) missense probably benign
R5901:Cfap43 UTSW 19 47,885,538 (GRCm39) missense probably damaging 0.97
R5910:Cfap43 UTSW 19 47,768,710 (GRCm39) missense possibly damaging 0.63
R5920:Cfap43 UTSW 19 47,749,335 (GRCm39) missense possibly damaging 0.88
R5963:Cfap43 UTSW 19 47,734,013 (GRCm39) missense probably benign 0.42
R6817:Cfap43 UTSW 19 47,744,524 (GRCm39) missense possibly damaging 0.88
R6974:Cfap43 UTSW 19 47,773,717 (GRCm39) critical splice donor site probably null
R7219:Cfap43 UTSW 19 47,779,912 (GRCm39) missense probably benign 0.02
R7270:Cfap43 UTSW 19 47,728,224 (GRCm39) missense possibly damaging 0.86
R7733:Cfap43 UTSW 19 47,886,432 (GRCm39) missense possibly damaging 0.75
R7995:Cfap43 UTSW 19 47,886,462 (GRCm39) missense probably damaging 1.00
R8013:Cfap43 UTSW 19 47,761,548 (GRCm39) missense probably damaging 0.99
R8176:Cfap43 UTSW 19 47,784,114 (GRCm39) missense probably benign 0.00
R8242:Cfap43 UTSW 19 47,885,808 (GRCm39) missense probably damaging 1.00
R8303:Cfap43 UTSW 19 47,754,274 (GRCm39) nonsense probably null
R8333:Cfap43 UTSW 19 47,885,765 (GRCm39) nonsense probably null
R8353:Cfap43 UTSW 19 47,735,086 (GRCm39) missense probably damaging 1.00
R8453:Cfap43 UTSW 19 47,735,086 (GRCm39) missense probably damaging 1.00
R8474:Cfap43 UTSW 19 47,886,363 (GRCm39) missense probably benign 0.32
R8478:Cfap43 UTSW 19 47,764,515 (GRCm39) missense probably benign 0.02
R8676:Cfap43 UTSW 19 47,736,456 (GRCm39) missense possibly damaging 0.95
R8928:Cfap43 UTSW 19 47,804,399 (GRCm39) missense probably benign 0.00
R9190:Cfap43 UTSW 19 47,726,293 (GRCm39) missense possibly damaging 0.65
R9426:Cfap43 UTSW 19 47,814,237 (GRCm39) missense probably damaging 0.99
R9491:Cfap43 UTSW 19 47,800,505 (GRCm39) critical splice donor site probably null
R9515:Cfap43 UTSW 19 47,773,814 (GRCm39) missense probably damaging 1.00
R9732:Cfap43 UTSW 19 47,775,446 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCACAAACTCCTGGGTGC -3'
(R):5'- ATGCCACGATTCCCGAGAAC -3'

Sequencing Primer
(F):5'- AAACTCCTGGGTGCGGGTG -3'
(R):5'- TCATACGCAAGATGCAGGAGC -3'
Posted On 2022-06-15