Mutagenetix > Incidental Mutation

Incidental Mutation 'R9451:Vmn2r23'

714252

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R9451 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123733393 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 552 (T552A)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158091

Predicted Effect

probably damaging
Transcript: ENSMUST00000172391
AA Change: T552A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: T552A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (73/73)

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	A	G	17: 23,717,213	Y19H	unknown	Het
Aldh8a1	T	A	10: 21,389,133	S220T	probably benign	Het
Ankrd66	A	G	17: 43,534,920	V192A	probably benign	Het
Atp1a2	A	G	1: 172,275,927	Y1009H	probably benign	Het
BC005561	C	A	5: 104,520,778	S1055R	probably benign	Het
Bptf	A	C	11: 107,044,585	M142R	probably damaging	Het
Brwd1	C	T	16: 96,044,503	R740Q	probably damaging	Het
C3	A	G	17: 57,224,169	M339T	probably benign	Het
Catsperg1	A	G	7: 29,198,347		probably null	Het
Cep295nl	T	A	11: 118,333,620	K133*	probably null	Het
Copg2	A	T	6: 30,816,851		probably benign	Het
Coro7	A	T	16: 4,670,538	D89E	probably damaging	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Ddx54	G	T	5: 120,627,144	R826L	probably damaging	Het
Dlg4	G	T	11: 70,031,239	K162N	probably damaging	Het
Dna2	T	A	10: 62,954,293	L185H	probably benign	Het
Dock9	C	T	14: 121,550,189		probably benign	Het
Efcab8	G	C	2: 153,804,941	V397L	unknown	Het
Etl4	A	G	2: 20,809,115	I1322V	probably benign	Het
Exd1	T	C	2: 119,524,583	K284E	possibly damaging	Het
Flnc	A	G	6: 29,445,463	T786A	probably damaging	Het
Gm21671	T	A	5: 25,951,571	K137*	probably null	Het
Gm29106	A	C	1: 118,199,914	E445D	possibly damaging	Het
Gm5592	T	C	7: 41,286,452	L126P	probably damaging	Het
Gtf3c2	T	G	5: 31,168,429	T389P	probably damaging	Het
Hhipl1	C	A	12: 108,327,841	R669S	probably benign	Het
Hivep1	A	G	13: 42,183,776	T2444A	probably benign	Het
Hspg2	A	G	4: 137,511,069	E289G	probably damaging	Het
Htatip2	C	A	7: 49,759,239	T9K	unknown	Het
Ifngr1	T	C	10: 19,607,293	V265A	possibly damaging	Het
Ift140	A	G	17: 25,033,951	N359D	probably benign	Het
Mat1a	A	G	14: 41,114,846	R178G	probably damaging	Het
Mknk2	C	T	10: 80,669,662	R154H	probably benign	Het
Myh14	C	T	7: 44,624,319		probably null	Het
Myof	A	G	19: 37,977,648		probably null	Het
Nfe2l1	G	T	11: 96,827,627	D27E	probably damaging	Het
Olfr1234	A	T	2: 89,362,899	C177S	probably damaging	Het
Olfr1301	T	C	2: 111,754,873	V208A	probably benign	Het
Olfr1378	A	G	11: 50,969,123	Y35C		Het
Olfr284	A	G	15: 98,340,263	V242A	possibly damaging	Het
Olfr485	A	G	7: 108,159,261	V204A	probably benign	Het
Plec	C	A	15: 76,183,787	Q1139H	unknown	Het
Plxna2	T	A	1: 194,644,384	S209T	probably benign	Het
Plxnd1	T	C	6: 115,963,316	E1369G	possibly damaging	Het
Psd3	T	C	8: 67,910,835	I3V	unknown	Het
Pwp1	T	A	10: 85,878,564	F195L	probably damaging	Het
Rab3ip	C	T	10: 116,939,449	M1I	probably null	Het
Rad54l2	T	C	9: 106,708,289	K759R	probably benign	Het
Rims2	G	T	15: 39,437,328	V344L	probably damaging	Het
Robo1	G	A	16: 73,006,830	R1088Q	probably benign	Het
Rtf2	A	G	2: 172,440,825		probably benign	Het
Serhl	A	C	15: 83,102,966	K131N	possibly damaging	Het
Sidt1	T	A	16: 44,255,029		probably null	Het
Slc27a1	T	A	8: 71,580,164	Y248*	probably null	Het
Slitrk3	T	A	3: 73,051,283	E52V	possibly damaging	Het
Snx2	T	C	18: 53,210,343	V271A	probably benign	Het
Snx9	C	A	17: 5,899,493	P156Q	probably damaging	Het
Spag6	C	A	2: 18,710,558	Y71*	probably null	Het
Speg	A	G	1: 75,417,733	D1724G	probably damaging	Het
Svs1	A	G	6: 48,988,840	Y594C	probably damaging	Het
Syt7	A	G	19: 10,444,168	N572S	probably damaging	Het
Ticam2	A	G	18: 46,560,699	I107T	probably damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmem268	G	A	4: 63,570,019	V135M	probably benign	Het
Toporsl	A	G	4: 52,611,663	T519A	possibly damaging	Het
Trim43b	G	A	9: 89,091,555	L42F	possibly damaging	Het
Ttf2	A	C	3: 100,944,773	V1019G	probably damaging	Het
Ugt3a1	A	G	15: 9,292,072	D97G	probably benign	Het
Uncx	A	G	5: 139,546,720	N180S	probably damaging	Het
Vmn2r51	A	T	7: 10,099,889	H407Q	probably damaging	Het
Wdfy4	C	T	14: 33,133,561	E699K		Het
Wdr95	A	G	5: 149,580,700	T324A	probably benign	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GATGCTAATACTGAATGGCATGAATGG -3'
(R):5'- CACTAAACTCAGTGCTGTTTTGC -3'

Sequencing Primer
(F):5'- GGCATGAATGGACTAACTTCCTTCTG -3'
(R):5'- CACTCTATAGATCAGGATGGCCTTG -3'

Posted On

2022-06-15