Mutagenetix > Incidental Mutation

Incidental Mutation 'R9451:Rad54l2'

714264

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9451 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106708289 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 759 (K759R)

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046502
AA Change: K759R

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: K759R

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Meta Mutation Damage Score

0.0616

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (73/73)

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	A	G	17: 23,717,213	Y19H	unknown	Het
Aldh8a1	T	A	10: 21,389,133	S220T	probably benign	Het
Ankrd66	A	G	17: 43,534,920	V192A	probably benign	Het
Atp1a2	A	G	1: 172,275,927	Y1009H	probably benign	Het
BC005561	C	A	5: 104,520,778	S1055R	probably benign	Het
Bptf	A	C	11: 107,044,585	M142R	probably damaging	Het
Brwd1	C	T	16: 96,044,503	R740Q	probably damaging	Het
C3	A	G	17: 57,224,169	M339T	probably benign	Het
Catsperg1	A	G	7: 29,198,347		probably null	Het
Cep295nl	T	A	11: 118,333,620	K133*	probably null	Het
Copg2	A	T	6: 30,816,851		probably benign	Het
Coro7	A	T	16: 4,670,538	D89E	probably damaging	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Ddx54	G	T	5: 120,627,144	R826L	probably damaging	Het
Dlg4	G	T	11: 70,031,239	K162N	probably damaging	Het
Dna2	T	A	10: 62,954,293	L185H	probably benign	Het
Dock9	C	T	14: 121,550,189		probably benign	Het
Efcab8	G	C	2: 153,804,941	V397L	unknown	Het
Etl4	A	G	2: 20,809,115	I1322V	probably benign	Het
Exd1	T	C	2: 119,524,583	K284E	possibly damaging	Het
Flnc	A	G	6: 29,445,463	T786A	probably damaging	Het
Gm21671	T	A	5: 25,951,571	K137*	probably null	Het
Gm29106	A	C	1: 118,199,914	E445D	possibly damaging	Het
Gm5592	T	C	7: 41,286,452	L126P	probably damaging	Het
Gtf3c2	T	G	5: 31,168,429	T389P	probably damaging	Het
Hhipl1	C	A	12: 108,327,841	R669S	probably benign	Het
Hivep1	A	G	13: 42,183,776	T2444A	probably benign	Het
Hspg2	A	G	4: 137,511,069	E289G	probably damaging	Het
Htatip2	C	A	7: 49,759,239	T9K	unknown	Het
Ifngr1	T	C	10: 19,607,293	V265A	possibly damaging	Het
Ift140	A	G	17: 25,033,951	N359D	probably benign	Het
Mat1a	A	G	14: 41,114,846	R178G	probably damaging	Het
Mknk2	C	T	10: 80,669,662	R154H	probably benign	Het
Myh14	C	T	7: 44,624,319		probably null	Het
Myof	A	G	19: 37,977,648		probably null	Het
Nfe2l1	G	T	11: 96,827,627	D27E	probably damaging	Het
Olfr1234	A	T	2: 89,362,899	C177S	probably damaging	Het
Olfr1301	T	C	2: 111,754,873	V208A	probably benign	Het
Olfr1378	A	G	11: 50,969,123	Y35C		Het
Olfr284	A	G	15: 98,340,263	V242A	possibly damaging	Het
Olfr485	A	G	7: 108,159,261	V204A	probably benign	Het
Plec	C	A	15: 76,183,787	Q1139H	unknown	Het
Plxna2	T	A	1: 194,644,384	S209T	probably benign	Het
Plxnd1	T	C	6: 115,963,316	E1369G	possibly damaging	Het
Psd3	T	C	8: 67,910,835	I3V	unknown	Het
Pwp1	T	A	10: 85,878,564	F195L	probably damaging	Het
Rab3ip	C	T	10: 116,939,449	M1I	probably null	Het
Rims2	G	T	15: 39,437,328	V344L	probably damaging	Het
Robo1	G	A	16: 73,006,830	R1088Q	probably benign	Het
Rtf2	A	G	2: 172,440,825		probably benign	Het
Serhl	A	C	15: 83,102,966	K131N	possibly damaging	Het
Sidt1	T	A	16: 44,255,029		probably null	Het
Slc27a1	T	A	8: 71,580,164	Y248*	probably null	Het
Slitrk3	T	A	3: 73,051,283	E52V	possibly damaging	Het
Snx2	T	C	18: 53,210,343	V271A	probably benign	Het
Snx9	C	A	17: 5,899,493	P156Q	probably damaging	Het
Spag6	C	A	2: 18,710,558	Y71*	probably null	Het
Speg	A	G	1: 75,417,733	D1724G	probably damaging	Het
Svs1	A	G	6: 48,988,840	Y594C	probably damaging	Het
Syt7	A	G	19: 10,444,168	N572S	probably damaging	Het
Ticam2	A	G	18: 46,560,699	I107T	probably damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmem268	G	A	4: 63,570,019	V135M	probably benign	Het
Toporsl	A	G	4: 52,611,663	T519A	possibly damaging	Het
Trim43b	G	A	9: 89,091,555	L42F	possibly damaging	Het
Ttf2	A	C	3: 100,944,773	V1019G	probably damaging	Het
Ugt3a1	A	G	15: 9,292,072	D97G	probably benign	Het
Uncx	A	G	5: 139,546,720	N180S	probably damaging	Het
Vmn2r23	A	G	6: 123,733,393	T552A	probably damaging	Het
Vmn2r51	A	T	7: 10,099,889	H407Q	probably damaging	Het
Wdfy4	C	T	14: 33,133,561	E699K		Het
Wdr95	A	G	5: 149,580,700	T324A	probably benign	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9523:Rad54l2	UTSW	9	106695952	missense	probably damaging	1.00
R9657:Rad54l2	UTSW	9	106704173	missense	probably damaging	0.99
R9757:Rad54l2	UTSW	9	106717921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTAGCCCTAGCAGTGGTTC -3'
(R):5'- GGTCGGTGCTCATAAATCTATGG -3'

Sequencing Primer
(F):5'- TGGCTAATCACATATTTCTACACAC -3'
(R):5'- CTATGGGTTAGGGAGAATATTTTGGC -3'

Posted On

2022-06-15