Incidental Mutation 'R9451:Rad54l2'
ID 714264
Institutional Source Beutler Lab
Gene Symbol Rad54l2
Ensembl Gene ENSMUSG00000040661
Gene Name RAD54 like 2 (S. cerevisiae)
Synonyms Srisnf2l, G630026H09Rik, Arip4
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9451 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 106565281-106666393 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106585488 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 759 (K759R)
Ref Sequence ENSEMBL: ENSMUSP00000045454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046502]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046502
AA Change: K759R

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: K759R

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 130 146 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 215 229 N/A INTRINSIC
DEXDc 267 520 4.21e-20 SMART
HELICc 751 854 1.88e-17 SMART
low complexity region 959 976 N/A INTRINSIC
low complexity region 1348 1368 N/A INTRINSIC
low complexity region 1453 1460 N/A INTRINSIC
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 T A 10: 21,265,032 (GRCm39) S220T probably benign Het
Ankrd66 A G 17: 43,845,811 (GRCm39) V192A probably benign Het
Aoc1l3 A G 6: 48,965,774 (GRCm39) Y594C probably damaging Het
Atp1a2 A G 1: 172,103,494 (GRCm39) Y1009H probably benign Het
Bptf A C 11: 106,935,411 (GRCm39) M142R probably damaging Het
Brwd1 C T 16: 95,845,703 (GRCm39) R740Q probably damaging Het
C3 A G 17: 57,531,169 (GRCm39) M339T probably benign Het
Catsperg1 A G 7: 28,897,772 (GRCm39) probably null Het
Cep295nl T A 11: 118,224,446 (GRCm39) K133* probably null Het
Copg2 A T 6: 30,793,786 (GRCm39) probably benign Het
Coro7 A T 16: 4,488,402 (GRCm39) D89E probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Ddx54 G T 5: 120,765,209 (GRCm39) R826L probably damaging Het
Dlg4 G T 11: 69,922,065 (GRCm39) K162N probably damaging Het
Dna2 T A 10: 62,790,072 (GRCm39) L185H probably benign Het
Dock9 C T 14: 121,787,601 (GRCm39) probably benign Het
Efcab8 G C 2: 153,646,861 (GRCm39) V397L unknown Het
Etl4 A G 2: 20,813,926 (GRCm39) I1322V probably benign Het
Exd1 T C 2: 119,355,064 (GRCm39) K284E possibly damaging Het
Flnc A G 6: 29,445,462 (GRCm39) T786A probably damaging Het
Gm29106 A C 1: 118,127,644 (GRCm39) E445D possibly damaging Het
Gm5592 T C 7: 40,935,876 (GRCm39) L126P probably damaging Het
Grep1 A G 17: 23,936,187 (GRCm39) Y19H unknown Het
Gtf3c2 T G 5: 31,325,773 (GRCm39) T389P probably damaging Het
Hhipl1 C A 12: 108,294,100 (GRCm39) R669S probably benign Het
Hivep1 A G 13: 42,337,252 (GRCm39) T2444A probably benign Het
Hspg2 A G 4: 137,238,380 (GRCm39) E289G probably damaging Het
Htatip2 C A 7: 49,408,987 (GRCm39) T9K unknown Het
Ifngr1 T C 10: 19,483,041 (GRCm39) V265A possibly damaging Het
Ift140 A G 17: 25,252,925 (GRCm39) N359D probably benign Het
Mat1a A G 14: 40,836,803 (GRCm39) R178G probably damaging Het
Mknk2 C T 10: 80,505,496 (GRCm39) R154H probably benign Het
Myh14 C T 7: 44,273,743 (GRCm39) probably null Het
Myof A G 19: 37,966,096 (GRCm39) probably null Het
Nfe2l1 G T 11: 96,718,453 (GRCm39) D27E probably damaging Het
Or1ad6 A G 11: 50,859,950 (GRCm39) Y35C Het
Or4a15 A T 2: 89,193,243 (GRCm39) C177S probably damaging Het
Or4k51 T C 2: 111,585,218 (GRCm39) V208A probably benign Het
Or5p61 A G 7: 107,758,468 (GRCm39) V204A probably benign Het
Or8s5 A G 15: 98,238,144 (GRCm39) V242A possibly damaging Het
Plec C A 15: 76,067,987 (GRCm39) Q1139H unknown Het
Plxna2 T A 1: 194,326,692 (GRCm39) S209T probably benign Het
Plxnd1 T C 6: 115,940,277 (GRCm39) E1369G possibly damaging Het
Psd3 T C 8: 68,363,487 (GRCm39) I3V unknown Het
Pwp1 T A 10: 85,714,428 (GRCm39) F195L probably damaging Het
Rab3ip C T 10: 116,775,354 (GRCm39) M1I probably null Het
Rims2 G T 15: 39,300,724 (GRCm39) V344L probably damaging Het
Robo1 G A 16: 72,803,718 (GRCm39) R1088Q probably benign Het
Rtf2 A G 2: 172,282,745 (GRCm39) probably benign Het
Serhl A C 15: 82,987,167 (GRCm39) K131N possibly damaging Het
Sidt1 T A 16: 44,075,392 (GRCm39) probably null Het
Slc27a1 T A 8: 72,032,808 (GRCm39) Y248* probably null Het
Slitrk3 T A 3: 72,958,616 (GRCm39) E52V possibly damaging Het
Snx2 T C 18: 53,343,415 (GRCm39) V271A probably benign Het
Snx9 C A 17: 5,949,768 (GRCm39) P156Q probably damaging Het
Spag6 C A 2: 18,715,369 (GRCm39) Y71* probably null Het
Speer4a3 T A 5: 26,156,569 (GRCm39) K137* probably null Het
Speg A G 1: 75,394,377 (GRCm39) D1724G probably damaging Het
Syt7 A G 19: 10,421,532 (GRCm39) N572S probably damaging Het
Thoc2l C A 5: 104,668,644 (GRCm39) S1055R probably benign Het
Ticam2 A G 18: 46,693,766 (GRCm39) I107T probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem268 G A 4: 63,488,256 (GRCm39) V135M probably benign Het
Toporsl A G 4: 52,611,663 (GRCm39) T519A possibly damaging Het
Trim43b G A 9: 88,973,608 (GRCm39) L42F possibly damaging Het
Ttf2 A C 3: 100,852,089 (GRCm39) V1019G probably damaging Het
Ugt3a1 A G 15: 9,292,158 (GRCm39) D97G probably benign Het
Uncx A G 5: 139,532,475 (GRCm39) N180S probably damaging Het
Vmn2r23 A G 6: 123,710,352 (GRCm39) T552A probably damaging Het
Vmn2r51 A T 7: 9,833,816 (GRCm39) H407Q probably damaging Het
Wdfy4 C T 14: 32,855,518 (GRCm39) E699K Het
Wdr95 A G 5: 149,504,165 (GRCm39) T324A probably benign Het
Other mutations in Rad54l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Rad54l2 APN 9 106,577,760 (GRCm39) missense probably benign
IGL00718:Rad54l2 APN 9 106,590,654 (GRCm39) missense probably damaging 1.00
IGL00917:Rad54l2 APN 9 106,587,638 (GRCm39) missense possibly damaging 0.95
IGL01319:Rad54l2 APN 9 106,596,245 (GRCm39) missense probably benign 0.18
IGL01447:Rad54l2 APN 9 106,579,971 (GRCm39) missense probably damaging 1.00
IGL01469:Rad54l2 APN 9 106,599,957 (GRCm39) missense probably damaging 1.00
IGL01836:Rad54l2 APN 9 106,593,356 (GRCm39) missense probably benign 0.00
IGL02017:Rad54l2 APN 9 106,631,239 (GRCm39) missense possibly damaging 0.85
IGL02179:Rad54l2 APN 9 106,597,589 (GRCm39) missense probably damaging 1.00
IGL02348:Rad54l2 APN 9 106,597,575 (GRCm39) missense probably damaging 1.00
IGL02822:Rad54l2 APN 9 106,587,606 (GRCm39) missense probably damaging 1.00
IGL03169:Rad54l2 APN 9 106,596,263 (GRCm39) missense probably benign 0.37
IGL03245:Rad54l2 APN 9 106,580,827 (GRCm39) missense probably damaging 1.00
IGL03253:Rad54l2 APN 9 106,581,422 (GRCm39) missense probably damaging 1.00
IGL02988:Rad54l2 UTSW 9 106,577,784 (GRCm39) missense probably benign
PIT4495001:Rad54l2 UTSW 9 106,593,343 (GRCm39) missense probably benign 0.02
R0001:Rad54l2 UTSW 9 106,585,416 (GRCm39) missense probably damaging 0.97
R0069:Rad54l2 UTSW 9 106,587,564 (GRCm39) missense possibly damaging 0.67
R0069:Rad54l2 UTSW 9 106,587,564 (GRCm39) missense possibly damaging 0.67
R0114:Rad54l2 UTSW 9 106,590,654 (GRCm39) missense probably damaging 1.00
R0427:Rad54l2 UTSW 9 106,570,891 (GRCm39) missense possibly damaging 0.65
R0519:Rad54l2 UTSW 9 106,585,498 (GRCm39) missense probably damaging 0.98
R0760:Rad54l2 UTSW 9 106,596,805 (GRCm39) critical splice donor site probably null
R1018:Rad54l2 UTSW 9 106,589,589 (GRCm39) missense probably benign 0.32
R1630:Rad54l2 UTSW 9 106,580,828 (GRCm39) missense possibly damaging 0.79
R1701:Rad54l2 UTSW 9 106,577,692 (GRCm39) critical splice donor site probably null
R1903:Rad54l2 UTSW 9 106,570,916 (GRCm39) splice site probably null
R2187:Rad54l2 UTSW 9 106,631,191 (GRCm39) small deletion probably benign
R2205:Rad54l2 UTSW 9 106,594,997 (GRCm39) missense probably damaging 1.00
R2566:Rad54l2 UTSW 9 106,580,825 (GRCm39) missense possibly damaging 0.95
R2983:Rad54l2 UTSW 9 106,577,789 (GRCm39) missense probably benign 0.10
R3176:Rad54l2 UTSW 9 106,631,142 (GRCm39) critical splice donor site probably null
R3276:Rad54l2 UTSW 9 106,631,142 (GRCm39) critical splice donor site probably null
R3718:Rad54l2 UTSW 9 106,570,726 (GRCm39) missense probably benign
R4063:Rad54l2 UTSW 9 106,597,613 (GRCm39) missense probably benign 0.10
R4206:Rad54l2 UTSW 9 106,594,994 (GRCm39) missense probably damaging 1.00
R4271:Rad54l2 UTSW 9 106,570,825 (GRCm39) missense probably benign 0.22
R4377:Rad54l2 UTSW 9 106,570,421 (GRCm39) missense probably benign 0.00
R4700:Rad54l2 UTSW 9 106,631,224 (GRCm39) missense possibly damaging 0.85
R4729:Rad54l2 UTSW 9 106,593,317 (GRCm39) missense probably benign
R4872:Rad54l2 UTSW 9 106,595,091 (GRCm39) missense probably damaging 1.00
R4997:Rad54l2 UTSW 9 106,600,108 (GRCm39) missense possibly damaging 0.70
R5475:Rad54l2 UTSW 9 106,583,057 (GRCm39) missense probably damaging 1.00
R5658:Rad54l2 UTSW 9 106,631,191 (GRCm39) small deletion probably benign
R6246:Rad54l2 UTSW 9 106,577,692 (GRCm39) critical splice donor site probably null
R6248:Rad54l2 UTSW 9 106,587,537 (GRCm39) missense probably damaging 1.00
R6329:Rad54l2 UTSW 9 106,595,121 (GRCm39) missense possibly damaging 0.89
R6631:Rad54l2 UTSW 9 106,590,739 (GRCm39) nonsense probably null
R6773:Rad54l2 UTSW 9 106,570,516 (GRCm39) missense probably benign
R7148:Rad54l2 UTSW 9 106,596,318 (GRCm39) nonsense probably null
R7171:Rad54l2 UTSW 9 106,590,677 (GRCm39) missense probably damaging 1.00
R7226:Rad54l2 UTSW 9 106,590,671 (GRCm39) missense probably damaging 0.99
R7327:Rad54l2 UTSW 9 106,570,660 (GRCm39) missense possibly damaging 0.68
R7337:Rad54l2 UTSW 9 106,583,024 (GRCm39) missense probably damaging 1.00
R7636:Rad54l2 UTSW 9 106,597,586 (GRCm39) missense probably damaging 1.00
R7659:Rad54l2 UTSW 9 106,590,777 (GRCm39) missense probably benign 0.11
R7713:Rad54l2 UTSW 9 106,594,422 (GRCm39) missense probably damaging 1.00
R7748:Rad54l2 UTSW 9 106,596,233 (GRCm39) missense possibly damaging 0.53
R8021:Rad54l2 UTSW 9 106,596,840 (GRCm39) missense probably benign 0.00
R8084:Rad54l2 UTSW 9 106,590,701 (GRCm39) missense possibly damaging 0.63
R8552:Rad54l2 UTSW 9 106,570,777 (GRCm39) missense possibly damaging 0.77
R8768:Rad54l2 UTSW 9 106,596,809 (GRCm39) missense probably benign 0.04
R8952:Rad54l2 UTSW 9 106,566,050 (GRCm39) unclassified probably benign
R8953:Rad54l2 UTSW 9 106,570,461 (GRCm39) missense probably benign 0.02
R9041:Rad54l2 UTSW 9 106,600,018 (GRCm39) missense possibly damaging 0.85
R9296:Rad54l2 UTSW 9 106,579,942 (GRCm39) missense probably damaging 1.00
R9523:Rad54l2 UTSW 9 106,573,151 (GRCm39) missense probably damaging 1.00
R9657:Rad54l2 UTSW 9 106,581,372 (GRCm39) missense probably damaging 0.99
R9757:Rad54l2 UTSW 9 106,595,120 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCCCTAGCAGTGGTTC -3'
(R):5'- GGTCGGTGCTCATAAATCTATGG -3'

Sequencing Primer
(F):5'- TGGCTAATCACATATTTCTACACAC -3'
(R):5'- CTATGGGTTAGGGAGAATATTTTGGC -3'
Posted On 2022-06-15