Incidental Mutation 'R9451:Rab3ip'
ID 714270
Institutional Source Beutler Lab
Gene Symbol Rab3ip
Ensembl Gene ENSMUSG00000064181
Gene Name RAB3A interacting protein
Synonyms Rabin3, Gtpat12, SSX2 interacting protein
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9451 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 116905784-116950769 bp(-) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) C to T at 116939449 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000151708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020375] [ENSMUST00000218391] [ENSMUST00000219109] [ENSMUST00000219603]
AlphaFold Q68EF0
Predicted Effect probably null
Transcript: ENSMUST00000020375
AA Change: M1I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020375
Gene: ENSMUSG00000064181
AA Change: M1I

DomainStartEndE-ValueType
low complexity region 84 100 N/A INTRINSIC
PDB:4LHZ|F 157 200 9e-15 PDB
low complexity region 213 220 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218391
AA Change: M1I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably null
Transcript: ENSMUST00000219109
AA Change: M1I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably null
Transcript: ENSMUST00000219603
AA Change: M1I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are fertile and show no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,717,213 Y19H unknown Het
Aldh8a1 T A 10: 21,389,133 S220T probably benign Het
Ankrd66 A G 17: 43,534,920 V192A probably benign Het
Atp1a2 A G 1: 172,275,927 Y1009H probably benign Het
BC005561 C A 5: 104,520,778 S1055R probably benign Het
Bptf A C 11: 107,044,585 M142R probably damaging Het
Brwd1 C T 16: 96,044,503 R740Q probably damaging Het
C3 A G 17: 57,224,169 M339T probably benign Het
Catsperg1 A G 7: 29,198,347 probably null Het
Cep295nl T A 11: 118,333,620 K133* probably null Het
Coro7 A T 16: 4,670,538 D89E probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Ddx54 G T 5: 120,627,144 R826L probably damaging Het
Dlg4 G T 11: 70,031,239 K162N probably damaging Het
Dna2 T A 10: 62,954,293 L185H probably benign Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Etl4 A G 2: 20,809,115 I1322V probably benign Het
Exd1 T C 2: 119,524,583 K284E possibly damaging Het
Flnc A G 6: 29,445,463 T786A probably damaging Het
Gm21671 T A 5: 25,951,571 K137* probably null Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gm29106 A C 1: 118,199,914 E445D possibly damaging Het
Gm5592 T C 7: 41,286,452 L126P probably damaging Het
Gtf3c2 T G 5: 31,168,429 T389P probably damaging Het
Hhipl1 C A 12: 108,327,841 R669S probably benign Het
Hivep1 A G 13: 42,183,776 T2444A probably benign Het
Hspg2 A G 4: 137,511,069 E289G probably damaging Het
Htatip2 C A 7: 49,759,239 T9K unknown Het
Ifngr1 T C 10: 19,607,293 V265A possibly damaging Het
Ift140 A G 17: 25,033,951 N359D probably benign Het
Mat1a A G 14: 41,114,846 R178G probably damaging Het
Mknk2 C T 10: 80,669,662 R154H probably benign Het
Myh14 C T 7: 44,624,319 probably null Het
Myof A G 19: 37,977,648 probably null Het
Nfe2l1 G T 11: 96,827,627 D27E probably damaging Het
Olfr1234 A T 2: 89,362,899 C177S probably damaging Het
Olfr1301 T C 2: 111,754,873 V208A probably benign Het
Olfr1378 A G 11: 50,969,123 Y35C Het
Olfr284 A G 15: 98,340,263 V242A possibly damaging Het
Olfr485 A G 7: 108,159,261 V204A probably benign Het
Plec C A 15: 76,183,787 Q1139H unknown Het
Plxna2 T A 1: 194,644,384 S209T probably benign Het
Plxnd1 T C 6: 115,963,316 E1369G possibly damaging Het
Psd3 T C 8: 67,910,835 I3V unknown Het
Pwp1 T A 10: 85,878,564 F195L probably damaging Het
Rad54l2 T C 9: 106,708,289 K759R probably benign Het
Rims2 G T 15: 39,437,328 V344L probably damaging Het
Robo1 G A 16: 73,006,830 R1088Q probably benign Het
Serhl A C 15: 83,102,966 K131N possibly damaging Het
Sidt1 T A 16: 44,255,029 probably null Het
Slc27a1 T A 8: 71,580,164 Y248* probably null Het
Slitrk3 T A 3: 73,051,283 E52V possibly damaging Het
Snx2 T C 18: 53,210,343 V271A probably benign Het
Snx9 C A 17: 5,899,493 P156Q probably damaging Het
Spag6 C A 2: 18,710,558 Y71* probably null Het
Speg A G 1: 75,417,733 D1724G probably damaging Het
Svs1 A G 6: 48,988,840 Y594C probably damaging Het
Syt7 A G 19: 10,444,168 N572S probably damaging Het
Ticam2 A G 18: 46,560,699 I107T probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem268 G A 4: 63,570,019 V135M probably benign Het
Toporsl A G 4: 52,611,663 T519A possibly damaging Het
Trim43b G A 9: 89,091,555 L42F possibly damaging Het
Ttf2 A C 3: 100,944,773 V1019G probably damaging Het
Ugt3a1 A G 15: 9,292,072 D97G probably benign Het
Uncx A G 5: 139,546,720 N180S probably damaging Het
Vmn2r23 A G 6: 123,733,393 T552A probably damaging Het
Vmn2r51 A T 7: 10,099,889 H407Q probably damaging Het
Wdfy4 C T 14: 33,133,561 E699K Het
Wdr95 A G 5: 149,580,700 T324A probably benign Het
Other mutations in Rab3ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Rab3ip APN 10 116907092 missense probably benign 0.09
IGL01946:Rab3ip APN 10 116937395 critical splice donor site probably null
IGL02665:Rab3ip APN 10 116937548 missense probably benign 0.02
R1538:Rab3ip UTSW 10 116939254 missense probably damaging 1.00
R1565:Rab3ip UTSW 10 116939223 missense probably benign 0.09
R1760:Rab3ip UTSW 10 116937510 missense probably damaging 1.00
R2077:Rab3ip UTSW 10 116918960 missense possibly damaging 0.87
R4441:Rab3ip UTSW 10 116915932 missense probably benign 0.19
R5442:Rab3ip UTSW 10 116918848 missense probably benign
R5526:Rab3ip UTSW 10 116918929 missense possibly damaging 0.61
R5682:Rab3ip UTSW 10 116907103 nonsense probably null
R5921:Rab3ip UTSW 10 116939247 missense probably damaging 1.00
R6254:Rab3ip UTSW 10 116915867 missense probably damaging 1.00
R7021:Rab3ip UTSW 10 116939378 missense probably damaging 1.00
R7026:Rab3ip UTSW 10 116937536 missense probably benign 0.18
R7326:Rab3ip UTSW 10 116937633 missense probably benign 0.07
R7408:Rab3ip UTSW 10 116937641 missense possibly damaging 0.62
R7655:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R7656:Rab3ip UTSW 10 116914139 missense probably benign 0.04
R8363:Rab3ip UTSW 10 116918964 missense probably damaging 1.00
R8537:Rab3ip UTSW 10 116910154 missense probably damaging 1.00
R9085:Rab3ip UTSW 10 116939405 missense probably damaging 1.00
R9086:Rab3ip UTSW 10 116939405 missense probably damaging 1.00
R9161:Rab3ip UTSW 10 116914161 missense probably damaging 1.00
R9563:Rab3ip UTSW 10 116918763 missense probably null 1.00
R9564:Rab3ip UTSW 10 116915875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGAAAGATCTAAGGCATTGGC -3'
(R):5'- CCGACTGAGACAACATTTCTGC -3'

Sequencing Primer
(F):5'- GCATTGGCCTGGAGAGG -3'
(R):5'- GACTGAGACAACATTTCTGCATTTCC -3'
Posted On 2022-06-15