Mutagenetix > Incidental Mutation

Incidental Mutation 'R9451:Bptf'

714274

Institutional Source

Beutler Lab

Gene Symbol

Bptf

Ensembl Gene

ENSMUSG00000040481

Gene Name

bromodomain PHD finger transcription factor

Synonyms

9430093H17Rik, Falz

MMRRC Submission

Accession Numbers

Genbank: NM_176850; MGI: 2444008

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9451 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107033081-107132127 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 107044585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 142 (M142R)

Ref Sequence

ENSEMBL: ENSMUSP00000146600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763] [ENSMUST00000133317] [ENSMUST00000208369]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000057892

SMART Domains

Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
coiled coil region	864	894	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1062	1072	N/A	INTRINSIC
low complexity region	1086	1098	N/A	INTRINSIC
low complexity region	1225	1238	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1491	1503	N/A	INTRINSIC
low complexity region	1594	1613	N/A	INTRINSIC
low complexity region	1636	1645	N/A	INTRINSIC
low complexity region	1665	1683	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
coiled coil region	1908	1936	N/A	INTRINSIC
low complexity region	1941	1957	N/A	INTRINSIC
low complexity region	2051	2061	N/A	INTRINSIC
low complexity region	2092	2107	N/A	INTRINSIC
low complexity region	2115	2128	N/A	INTRINSIC
low complexity region	2175	2197	N/A	INTRINSIC
low complexity region	2227	2252	N/A	INTRINSIC
low complexity region	2275	2312	N/A	INTRINSIC
low complexity region	2336	2355	N/A	INTRINSIC
low complexity region	2361	2378	N/A	INTRINSIC
low complexity region	2390	2420	N/A	INTRINSIC
low complexity region	2430	2463	N/A	INTRINSIC
coiled coil region	2489	2527	N/A	INTRINSIC
coiled coil region	2576	2604	N/A	INTRINSIC
low complexity region	2663	2700	N/A	INTRINSIC
low complexity region	2713	2736	N/A	INTRINSIC
PHD	2744	2791	5.32e-9	SMART
BROMO	2800	2908	5.5e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106762

SMART Domains

Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
internal_repeat_1	589	642	6.48e-5	PROSPERO
low complexity region	644	654	N/A	INTRINSIC
low complexity region	662	679	N/A	INTRINSIC
coiled coil region	926	956	N/A	INTRINSIC
low complexity region	1013	1025	N/A	INTRINSIC
low complexity region	1039	1050	N/A	INTRINSIC
low complexity region	1114	1124	N/A	INTRINSIC
low complexity region	1138	1150	N/A	INTRINSIC
low complexity region	1277	1290	N/A	INTRINSIC
low complexity region	1303	1317	N/A	INTRINSIC
internal_repeat_1	1387	1440	6.48e-5	PROSPERO
low complexity region	1543	1555	N/A	INTRINSIC
low complexity region	1646	1665	N/A	INTRINSIC
low complexity region	1688	1697	N/A	INTRINSIC
low complexity region	1717	1735	N/A	INTRINSIC
low complexity region	1870	1886	N/A	INTRINSIC
coiled coil region	1960	1988	N/A	INTRINSIC
low complexity region	1993	2009	N/A	INTRINSIC
low complexity region	2103	2113	N/A	INTRINSIC
low complexity region	2144	2159	N/A	INTRINSIC
low complexity region	2167	2180	N/A	INTRINSIC
low complexity region	2227	2249	N/A	INTRINSIC
low complexity region	2279	2304	N/A	INTRINSIC
low complexity region	2327	2364	N/A	INTRINSIC
low complexity region	2388	2407	N/A	INTRINSIC
low complexity region	2413	2430	N/A	INTRINSIC
low complexity region	2442	2472	N/A	INTRINSIC
low complexity region	2482	2515	N/A	INTRINSIC
coiled coil region	2541	2579	N/A	INTRINSIC
coiled coil region	2628	2656	N/A	INTRINSIC
low complexity region	2715	2752	N/A	INTRINSIC
low complexity region	2765	2788	N/A	INTRINSIC
PHD	2796	2843	5.32e-9	SMART
BROMO	2852	2960	5.5e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106763

SMART Domains

Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.9e-8	PFAM
PHD	404	447	2.23e-11	SMART
low complexity region	624	639	N/A	INTRINSIC
low complexity region	707	717	N/A	INTRINSIC
low complexity region	725	742	N/A	INTRINSIC
coiled coil region	989	1019	N/A	INTRINSIC
low complexity region	1076	1088	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
low complexity region	1177	1187	N/A	INTRINSIC
low complexity region	1201	1213	N/A	INTRINSIC
low complexity region	1340	1353	N/A	INTRINSIC
low complexity region	1366	1380	N/A	INTRINSIC
low complexity region	1606	1618	N/A	INTRINSIC
low complexity region	1709	1728	N/A	INTRINSIC
low complexity region	1751	1760	N/A	INTRINSIC
low complexity region	1780	1798	N/A	INTRINSIC
low complexity region	1933	1949	N/A	INTRINSIC
coiled coil region	2023	2051	N/A	INTRINSIC
low complexity region	2056	2072	N/A	INTRINSIC
low complexity region	2166	2176	N/A	INTRINSIC
low complexity region	2207	2222	N/A	INTRINSIC
low complexity region	2230	2243	N/A	INTRINSIC
low complexity region	2290	2312	N/A	INTRINSIC
low complexity region	2342	2367	N/A	INTRINSIC
low complexity region	2390	2427	N/A	INTRINSIC
low complexity region	2451	2470	N/A	INTRINSIC
low complexity region	2476	2493	N/A	INTRINSIC
low complexity region	2505	2535	N/A	INTRINSIC
low complexity region	2545	2578	N/A	INTRINSIC
coiled coil region	2604	2642	N/A	INTRINSIC
coiled coil region	2691	2719	N/A	INTRINSIC
low complexity region	2778	2815	N/A	INTRINSIC
low complexity region	2828	2851	N/A	INTRINSIC
PHD	2859	2906	5.32e-9	SMART
BROMO	2915	3023	5.5e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133317

SMART Domains

Protein: ENSMUSP00000118875
Gene: ENSMUSG00000040481

Domain	Start	End	E-Value	Type
low complexity region	57	94	N/A	INTRINSIC
low complexity region	107	130	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000208369
AA Change: M142R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]

Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	A	G	17: 23,717,213	Y19H	unknown	Het
Aldh8a1	T	A	10: 21,389,133	S220T	probably benign	Het
Ankrd66	A	G	17: 43,534,920	V192A	probably benign	Het
Atp1a2	A	G	1: 172,275,927	Y1009H	probably benign	Het
BC005561	C	A	5: 104,520,778	S1055R	probably benign	Het
Brwd1	C	T	16: 96,044,503	R740Q	probably damaging	Het
C3	A	G	17: 57,224,169	M339T	probably benign	Het
Catsperg1	A	G	7: 29,198,347		probably null	Het
Cep295nl	T	A	11: 118,333,620	K133*	probably null	Het
Copg2	A	T	6: 30,816,851		probably benign	Het
Coro7	A	T	16: 4,670,538	D89E	probably damaging	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Ddx54	G	T	5: 120,627,144	R826L	probably damaging	Het
Dlg4	G	T	11: 70,031,239	K162N	probably damaging	Het
Dna2	T	A	10: 62,954,293	L185H	probably benign	Het
Dock9	C	T	14: 121,550,189		probably benign	Het
Efcab8	G	C	2: 153,804,941	V397L	unknown	Het
Etl4	A	G	2: 20,809,115	I1322V	probably benign	Het
Exd1	T	C	2: 119,524,583	K284E	possibly damaging	Het
Flnc	A	G	6: 29,445,463	T786A	probably damaging	Het
Gm21671	T	A	5: 25,951,571	K137*	probably null	Het
Gm29106	A	C	1: 118,199,914	E445D	possibly damaging	Het
Gm5592	T	C	7: 41,286,452	L126P	probably damaging	Het
Gtf3c2	T	G	5: 31,168,429	T389P	probably damaging	Het
Hhipl1	C	A	12: 108,327,841	R669S	probably benign	Het
Hivep1	A	G	13: 42,183,776	T2444A	probably benign	Het
Hspg2	A	G	4: 137,511,069	E289G	probably damaging	Het
Htatip2	C	A	7: 49,759,239	T9K	unknown	Het
Ifngr1	T	C	10: 19,607,293	V265A	possibly damaging	Het
Ift140	A	G	17: 25,033,951	N359D	probably benign	Het
Mat1a	A	G	14: 41,114,846	R178G	probably damaging	Het
Mknk2	C	T	10: 80,669,662	R154H	probably benign	Het
Myh14	C	T	7: 44,624,319		probably null	Het
Myof	A	G	19: 37,977,648		probably null	Het
Nfe2l1	G	T	11: 96,827,627	D27E	probably damaging	Het
Olfr1234	A	T	2: 89,362,899	C177S	probably damaging	Het
Olfr1301	T	C	2: 111,754,873	V208A	probably benign	Het
Olfr1378	A	G	11: 50,969,123	Y35C		Het
Olfr284	A	G	15: 98,340,263	V242A	possibly damaging	Het
Olfr485	A	G	7: 108,159,261	V204A	probably benign	Het
Plec	C	A	15: 76,183,787	Q1139H	unknown	Het
Plxna2	T	A	1: 194,644,384	S209T	probably benign	Het
Plxnd1	T	C	6: 115,963,316	E1369G	possibly damaging	Het
Psd3	T	C	8: 67,910,835	I3V	unknown	Het
Pwp1	T	A	10: 85,878,564	F195L	probably damaging	Het
Rab3ip	C	T	10: 116,939,449	M1I	probably null	Het
Rad54l2	T	C	9: 106,708,289	K759R	probably benign	Het
Rims2	G	T	15: 39,437,328	V344L	probably damaging	Het
Robo1	G	A	16: 73,006,830	R1088Q	probably benign	Het
Rtf2	A	G	2: 172,440,825		probably benign	Het
Serhl	A	C	15: 83,102,966	K131N	possibly damaging	Het
Sidt1	T	A	16: 44,255,029		probably null	Het
Slc27a1	T	A	8: 71,580,164	Y248*	probably null	Het
Slitrk3	T	A	3: 73,051,283	E52V	possibly damaging	Het
Snx2	T	C	18: 53,210,343	V271A	probably benign	Het
Snx9	C	A	17: 5,899,493	P156Q	probably damaging	Het
Spag6	C	A	2: 18,710,558	Y71*	probably null	Het
Speg	A	G	1: 75,417,733	D1724G	probably damaging	Het
Svs1	A	G	6: 48,988,840	Y594C	probably damaging	Het
Syt7	A	G	19: 10,444,168	N572S	probably damaging	Het
Ticam2	A	G	18: 46,560,699	I107T	probably damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmem268	G	A	4: 63,570,019	V135M	probably benign	Het
Toporsl	A	G	4: 52,611,663	T519A	possibly damaging	Het
Trim43b	G	A	9: 89,091,555	L42F	possibly damaging	Het
Ttf2	A	C	3: 100,944,773	V1019G	probably damaging	Het
Ugt3a1	A	G	15: 9,292,072	D97G	probably benign	Het
Uncx	A	G	5: 139,546,720	N180S	probably damaging	Het
Vmn2r23	A	G	6: 123,733,393	T552A	probably damaging	Het
Vmn2r51	A	T	7: 10,099,889	H407Q	probably damaging	Het
Wdfy4	C	T	14: 33,133,561	E699K		Het
Wdr95	A	G	5: 149,580,700	T324A	probably benign	Het

Other mutations in Bptf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Bptf	APN	11	107055279	missense	possibly damaging	0.88
IGL00664:Bptf	APN	11	107077665	missense	possibly damaging	0.78
IGL00705:Bptf	APN	11	107095708	splice site	probably benign
IGL00796:Bptf	APN	11	107054550	missense	probably damaging	1.00
IGL00834:Bptf	APN	11	107073928	missense	possibly damaging	0.59
IGL01155:Bptf	APN	11	107080727	missense	probably damaging	1.00
IGL01314:Bptf	APN	11	107054853	missense	probably damaging	1.00
IGL01371:Bptf	APN	11	107055907	missense	probably benign	0.00
IGL01567:Bptf	APN	11	107058774	missense	probably damaging	1.00
IGL01794:Bptf	APN	11	107053221	critical splice donor site	probably null
IGL02108:Bptf	APN	11	107074988	missense	probably benign	0.45
IGL02367:Bptf	APN	11	107073352	missense	probably benign
IGL02437:Bptf	APN	11	107074695	missense	probably benign	0.00
IGL02589:Bptf	APN	11	107111531	missense	possibly damaging	0.92
IGL02897:Bptf	APN	11	107047121	missense	probably damaging	1.00
IGL02935:Bptf	APN	11	107080799	missense	probably damaging	1.00
IGL02954:Bptf	APN	11	107054749	missense	possibly damaging	0.89
IGL02982:Bptf	APN	11	107076674	missense	probably damaging	1.00
IGL03109:Bptf	APN	11	107061701	missense	possibly damaging	0.53
IGL03265:Bptf	APN	11	107054628	missense	probably benign	0.00
IGL03403:Bptf	APN	11	107099733	missense	possibly damaging	0.51
Anodyne	UTSW	11	107043631	critical splice donor site	probably null
Arroyo	UTSW	11	107042690	missense	probably benign	0.32
mojado	UTSW	11	107044640	missense	probably benign	0.03
IGL03097:Bptf	UTSW	11	107077680	missense	probably damaging	1.00
PIT4486001:Bptf	UTSW	11	107054788	missense	probably damaging	0.98
R0066:Bptf	UTSW	11	107062136	missense	possibly damaging	0.90
R0157:Bptf	UTSW	11	107074658	missense	possibly damaging	0.89
R0320:Bptf	UTSW	11	107072819	missense	probably damaging	1.00
R0328:Bptf	UTSW	11	107047127	missense	probably damaging	1.00
R0402:Bptf	UTSW	11	107074114	missense	probably damaging	1.00
R0482:Bptf	UTSW	11	107081262	missense	probably benign	0.13
R0574:Bptf	UTSW	11	107076527	missense	probably damaging	1.00
R0598:Bptf	UTSW	11	107072965	missense	probably damaging	0.99
R0599:Bptf	UTSW	11	107068382	missense	probably damaging	1.00
R0601:Bptf	UTSW	11	107061692	missense	probably benign	0.04
R0744:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0836:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0885:Bptf	UTSW	11	107043791	missense	probably damaging	1.00
R1070:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1252:Bptf	UTSW	11	107073251	missense	probably benign	0.00
R1370:Bptf	UTSW	11	107047094	missense	probably damaging	0.99
R1428:Bptf	UTSW	11	107073047	missense	probably damaging	0.99
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1742:Bptf	UTSW	11	107110951	missense	probably damaging	1.00
R1816:Bptf	UTSW	11	107060579	missense	probably damaging	1.00
R1858:Bptf	UTSW	11	107073301	missense	probably benign	0.00
R1989:Bptf	UTSW	11	107074826	missense	probably damaging	1.00
R2253:Bptf	UTSW	11	107111322	missense	probably damaging	1.00
R2392:Bptf	UTSW	11	107072747	missense	probably damaging	1.00
R2431:Bptf	UTSW	11	107047240	missense	possibly damaging	0.48
R3022:Bptf	UTSW	11	107111637	critical splice acceptor site	probably null
R3161:Bptf	UTSW	11	107074476	missense	probably damaging	1.00
R3686:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3687:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3688:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3787:Bptf	UTSW	11	107073827	missense	probably damaging	1.00
R3834:Bptf	UTSW	11	107073857	missense	probably benign	0.05
R3885:Bptf	UTSW	11	107074513	missense	probably damaging	0.97
R4090:Bptf	UTSW	11	107081523	missense	probably damaging	0.99
R4398:Bptf	UTSW	11	107110844	missense	probably damaging	1.00
R4437:Bptf	UTSW	11	107074474	missense	possibly damaging	0.59
R4514:Bptf	UTSW	11	107077692	missense	probably damaging	1.00
R4565:Bptf	UTSW	11	107073010	missense	probably damaging	1.00
R4715:Bptf	UTSW	11	107047181	missense	probably damaging	1.00
R4748:Bptf	UTSW	11	107095880	missense	probably damaging	0.96
R4764:Bptf	UTSW	11	107043694	missense	probably damaging	1.00
R4885:Bptf	UTSW	11	107074648	missense	probably benign	0.39
R4901:Bptf	UTSW	11	107110860	nonsense	probably null
R4995:Bptf	UTSW	11	107054565	missense	probably damaging	0.98
R5057:Bptf	UTSW	11	107082528	missense	probably damaging	0.98
R5120:Bptf	UTSW	11	107073385	missense	probably damaging	0.99
R5320:Bptf	UTSW	11	107081367	nonsense	probably null
R5329:Bptf	UTSW	11	107073295	missense	probably benign	0.06
R5418:Bptf	UTSW	11	107111294	missense	probably damaging	1.00
R5461:Bptf	UTSW	11	107061764	missense	probably damaging	1.00
R5664:Bptf	UTSW	11	107073699	missense	probably benign	0.01
R5718:Bptf	UTSW	11	107111434	missense	probably damaging	1.00
R5774:Bptf	UTSW	11	107111137	missense	probably damaging	1.00
R5851:Bptf	UTSW	11	107110862	missense	probably damaging	1.00
R5930:Bptf	UTSW	11	107073196	missense	probably damaging	1.00
R5949:Bptf	UTSW	11	107111089	missense	probably damaging	0.99
R5975:Bptf	UTSW	11	107035864	utr 3 prime	probably benign
R6027:Bptf	UTSW	11	107074945	missense	probably damaging	1.00
R6128:Bptf	UTSW	11	107074690	missense	possibly damaging	0.87
R6337:Bptf	UTSW	11	107058779	missense	possibly damaging	0.89
R6407:Bptf	UTSW	11	107111126	missense	probably damaging	1.00
R6470:Bptf	UTSW	11	107072767	missense	probably damaging	1.00
R6487:Bptf	UTSW	11	107077726	missense	probably damaging	0.99
R6501:Bptf	UTSW	11	107077683	missense	probably null	1.00
R6755:Bptf	UTSW	11	107047256	missense	probably benign	0.27
R6861:Bptf	UTSW	11	107062565	missense	probably damaging	1.00
R6866:Bptf	UTSW	11	107073580	missense	probably damaging	1.00
R6879:Bptf	UTSW	11	107042690	missense	probably benign	0.32
R6927:Bptf	UTSW	11	107054595	missense	probably damaging	1.00
R6944:Bptf	UTSW	11	107080823	missense	probably damaging	1.00
R7082:Bptf	UTSW	11	107086747	missense	probably benign	0.00
R7136:Bptf	UTSW	11	107099715	missense	probably damaging	1.00
R7162:Bptf	UTSW	11	107043631	critical splice donor site	probably null
R7171:Bptf	UTSW	11	107131407	missense	unknown
R7193:Bptf	UTSW	11	107054809	nonsense	probably null
R7210:Bptf	UTSW	11	107054464	nonsense	probably null
R7221:Bptf	UTSW	11	107054832	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107073109	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107110914	nonsense	probably null
R7422:Bptf	UTSW	11	107060558	missense	probably damaging	1.00
R7454:Bptf	UTSW	11	107044640	missense	probably benign	0.03
R7657:Bptf	UTSW	11	107074729	missense	probably damaging	1.00
R7718:Bptf	UTSW	11	107081456	missense	possibly damaging	0.65
R7827:Bptf	UTSW	11	107047187	missense	probably benign	0.01
R7844:Bptf	UTSW	11	107074061	missense	probably damaging	0.97
R7992:Bptf	UTSW	11	107110883	missense	probably benign	0.00
R8001:Bptf	UTSW	11	107047340	nonsense	probably null
R8037:Bptf	UTSW	11	107055950	missense	probably damaging	1.00
R8122:Bptf	UTSW	11	107036591	critical splice acceptor site	probably null
R8235:Bptf	UTSW	11	107076632	missense	probably benign	0.04
R8308:Bptf	UTSW	11	107052989	missense	probably damaging	0.99
R8409:Bptf	UTSW	11	107062669	missense	probably damaging	1.00
R8464:Bptf	UTSW	11	107131342	missense	probably benign	0.01
R8477:Bptf	UTSW	11	107052853	missense	probably damaging	0.98
R8482:Bptf	UTSW	11	107043698	missense	probably benign	0.19
R8515:Bptf	UTSW	11	107055238	missense	possibly damaging	0.85
R8519:Bptf	UTSW	11	107061764	missense	probably damaging	1.00
R8708:Bptf	UTSW	11	107073313	missense	probably damaging	0.99
R8708:Bptf	UTSW	11	107073314	missense	probably damaging	1.00
R8722:Bptf	UTSW	11	107131469	missense	unknown
R8732:Bptf	UTSW	11	107040380	missense	probably damaging	1.00
R8783:Bptf	UTSW	11	107131531	missense	unknown
R8828:Bptf	UTSW	11	107055010	missense	probably damaging	0.98
R9004:Bptf	UTSW	11	107054887	missense	probably damaging	1.00
R9010:Bptf	UTSW	11	107073750	missense	probably damaging	1.00
R9035:Bptf	UTSW	11	107073016	missense	probably damaging	1.00
R9083:Bptf	UTSW	11	107068350	missense	probably damaging	1.00
R9211:Bptf	UTSW	11	107055298	missense	probably damaging	1.00
R9345:Bptf	UTSW	11	107080762	missense	possibly damaging	0.77
R9393:Bptf	UTSW	11	107074308	missense	probably benign	0.00
R9561:Bptf	UTSW	11	107074128	nonsense	probably null
R9632:Bptf	UTSW	11	107061719	missense	probably damaging	1.00
R9648:Bptf	UTSW	11	107052894	missense	probably damaging	0.99
R9650:Bptf	UTSW	11	107044586	missense	probably benign	0.15
R9658:Bptf	UTSW	11	107111344	missense	probably damaging	1.00
R9775:Bptf	UTSW	11	107043676	missense	probably benign	0.04
R9776:Bptf	UTSW	11	107078570	missense	probably damaging	1.00
Z1088:Bptf	UTSW	11	107074582	missense	probably benign	0.00
Z1176:Bptf	UTSW	11	107058684	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATAGACACAGCAGAGAGGCCC -3'
(R):5'- AGGTGTTTAGCTGACTCATTGC -3'

Sequencing Primer
(F):5'- GCAGAGAGGCCCTGCTTTTTC -3'
(R):5'- GCTGACTCATTGCAGAAATTATCCTG -3'

Posted On

2022-06-15