Mutagenetix > Incidental Mutation

Incidental Mutation 'R9451:Wdfy4'

714278

Institutional Source

Beutler Lab

Gene Symbol

Wdfy4

Ensembl Gene

ENSMUSG00000051506

Gene Name

WD repeat and FYVE domain containing 4

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9451 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32959547-33185508 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 33133561 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 699 (E699K)

Ref Sequence

ENSEMBL: ENSMUSP00000117068 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000061753
AA Change: E699K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: E699K

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
low complexity region	1899	1909	N/A	INTRINSIC
Pfam:PH_BEACH	2237	2348	1.2e-9	PFAM
Beach	2378	2660	3.69e-196	SMART
WD40	2761	2801	1.98e1	SMART
WD40	2811	2850	5.18e-7	SMART
WD40	2853	2891	9.94e-1	SMART
WD40	2893	2940	3.17e-2	SMART
WD40	2986	3021	3.31e0	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: E699K

Domain	Start	End	E-Value	Type
low complexity region	69	77	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	508	522	N/A	INTRINSIC
low complexity region	618	632	N/A	INTRINSIC
low complexity region	644	661	N/A	INTRINSIC
low complexity region	1596	1615	N/A	INTRINSIC
low complexity region	1795	1819	N/A	INTRINSIC
low complexity region	2019	2029	N/A	INTRINSIC
Pfam:PH_BEACH	2362	2473	1.2e-9	PFAM
Beach	2503	2785	3.69e-196	SMART
WD40	2886	2926	1.98e1	SMART
WD40	2936	2975	5.18e-7	SMART
WD40	2978	3016	9.94e-1	SMART
WD40	3018	3065	3.17e-2	SMART
WD40	3111	3146	3.31e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (73/73)

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	A	G	17: 23,717,213	Y19H	unknown	Het
Aldh8a1	T	A	10: 21,389,133	S220T	probably benign	Het
Ankrd66	A	G	17: 43,534,920	V192A	probably benign	Het
Atp1a2	A	G	1: 172,275,927	Y1009H	probably benign	Het
BC005561	C	A	5: 104,520,778	S1055R	probably benign	Het
Bptf	A	C	11: 107,044,585	M142R	probably damaging	Het
Brwd1	C	T	16: 96,044,503	R740Q	probably damaging	Het
C3	A	G	17: 57,224,169	M339T	probably benign	Het
Catsperg1	A	G	7: 29,198,347		probably null	Het
Cep295nl	T	A	11: 118,333,620	K133*	probably null	Het
Copg2	A	T	6: 30,816,851		probably benign	Het
Coro7	A	T	16: 4,670,538	D89E	probably damaging	Het
Cyp2t4	G	A	7: 27,155,292	V66M	possibly damaging	Het
Ddx54	G	T	5: 120,627,144	R826L	probably damaging	Het
Dlg4	G	T	11: 70,031,239	K162N	probably damaging	Het
Dna2	T	A	10: 62,954,293	L185H	probably benign	Het
Dock9	C	T	14: 121,550,189		probably benign	Het
Efcab8	G	C	2: 153,804,941	V397L	unknown	Het
Etl4	A	G	2: 20,809,115	I1322V	probably benign	Het
Exd1	T	C	2: 119,524,583	K284E	possibly damaging	Het
Flnc	A	G	6: 29,445,463	T786A	probably damaging	Het
Gm21671	T	A	5: 25,951,571	K137*	probably null	Het
Gm29106	A	C	1: 118,199,914	E445D	possibly damaging	Het
Gm5592	T	C	7: 41,286,452	L126P	probably damaging	Het
Gtf3c2	T	G	5: 31,168,429	T389P	probably damaging	Het
Hhipl1	C	A	12: 108,327,841	R669S	probably benign	Het
Hivep1	A	G	13: 42,183,776	T2444A	probably benign	Het
Hspg2	A	G	4: 137,511,069	E289G	probably damaging	Het
Htatip2	C	A	7: 49,759,239	T9K	unknown	Het
Ifngr1	T	C	10: 19,607,293	V265A	possibly damaging	Het
Ift140	A	G	17: 25,033,951	N359D	probably benign	Het
Mat1a	A	G	14: 41,114,846	R178G	probably damaging	Het
Mknk2	C	T	10: 80,669,662	R154H	probably benign	Het
Myh14	C	T	7: 44,624,319		probably null	Het
Myof	A	G	19: 37,977,648		probably null	Het
Nfe2l1	G	T	11: 96,827,627	D27E	probably damaging	Het
Olfr1234	A	T	2: 89,362,899	C177S	probably damaging	Het
Olfr1301	T	C	2: 111,754,873	V208A	probably benign	Het
Olfr1378	A	G	11: 50,969,123	Y35C		Het
Olfr284	A	G	15: 98,340,263	V242A	possibly damaging	Het
Olfr485	A	G	7: 108,159,261	V204A	probably benign	Het
Plec	C	A	15: 76,183,787	Q1139H	unknown	Het
Plxna2	T	A	1: 194,644,384	S209T	probably benign	Het
Plxnd1	T	C	6: 115,963,316	E1369G	possibly damaging	Het
Psd3	T	C	8: 67,910,835	I3V	unknown	Het
Pwp1	T	A	10: 85,878,564	F195L	probably damaging	Het
Rab3ip	C	T	10: 116,939,449	M1I	probably null	Het
Rad54l2	T	C	9: 106,708,289	K759R	probably benign	Het
Rims2	G	T	15: 39,437,328	V344L	probably damaging	Het
Robo1	G	A	16: 73,006,830	R1088Q	probably benign	Het
Rtf2	A	G	2: 172,440,825		probably benign	Het
Serhl	A	C	15: 83,102,966	K131N	possibly damaging	Het
Sidt1	T	A	16: 44,255,029		probably null	Het
Slc27a1	T	A	8: 71,580,164	Y248*	probably null	Het
Slitrk3	T	A	3: 73,051,283	E52V	possibly damaging	Het
Snx2	T	C	18: 53,210,343	V271A	probably benign	Het
Snx9	C	A	17: 5,899,493	P156Q	probably damaging	Het
Spag6	C	A	2: 18,710,558	Y71*	probably null	Het
Speg	A	G	1: 75,417,733	D1724G	probably damaging	Het
Svs1	A	G	6: 48,988,840	Y594C	probably damaging	Het
Syt7	A	G	19: 10,444,168	N572S	probably damaging	Het
Ticam2	A	G	18: 46,560,699	I107T	probably damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmem268	G	A	4: 63,570,019	V135M	probably benign	Het
Toporsl	A	G	4: 52,611,663	T519A	possibly damaging	Het
Trim43b	G	A	9: 89,091,555	L42F	possibly damaging	Het
Ttf2	A	C	3: 100,944,773	V1019G	probably damaging	Het
Ugt3a1	A	G	15: 9,292,072	D97G	probably benign	Het
Uncx	A	G	5: 139,546,720	N180S	probably damaging	Het
Vmn2r23	A	G	6: 123,733,393	T552A	probably damaging	Het
Vmn2r51	A	T	7: 10,099,889	H407Q	probably damaging	Het
Wdr95	A	G	5: 149,580,700	T324A	probably benign	Het

Other mutations in Wdfy4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Wdfy4	APN	14	33102539	missense	possibly damaging	0.93
IGL01116:Wdfy4	APN	14	32959977	missense	probably damaging	1.00
IGL01449:Wdfy4	APN	14	33104037	missense	probably damaging	0.99
IGL01567:Wdfy4	APN	14	33151661	missense	probably benign	0.01
IGL01700:Wdfy4	APN	14	33020238	splice site	probably benign
IGL01931:Wdfy4	APN	14	33155753	missense	probably damaging	1.00
IGL01981:Wdfy4	APN	14	33133716	missense	probably damaging	1.00
IGL01988:Wdfy4	APN	14	33076480	missense	possibly damaging	0.75
IGL02026:Wdfy4	APN	14	33093300	missense	probably damaging	1.00
IGL02066:Wdfy4	APN	14	33149566	missense	probably benign
IGL02468:Wdfy4	APN	14	32966432	missense	probably benign	0.01
IGL02512:Wdfy4	APN	14	33042491	missense	probably benign	0.01
IGL02597:Wdfy4	APN	14	33090861	nonsense	probably null
IGL02752:Wdfy4	APN	14	33076326	missense	probably damaging	1.00
IGL02792:Wdfy4	APN	14	33095305	missense	probably benign	0.01
IGL02826:Wdfy4	APN	14	32971750	missense	possibly damaging	0.47
IGL02903:Wdfy4	APN	14	33109650	missense	probably damaging	1.00
IGL02955:Wdfy4	APN	14	33076284	missense	probably damaging	1.00
IGL03031:Wdfy4	APN	14	33140651	missense	probably damaging	1.00
IGL03102:Wdfy4	APN	14	32966435	missense	probably damaging	1.00
IGL03123:Wdfy4	APN	14	33162870	missense	probably benign	0.01
IGL03198:Wdfy4	APN	14	33125887	missense	probably damaging	1.00
IGL03250:Wdfy4	APN	14	32977167	missense	probably damaging	0.99
IGL03277:Wdfy4	APN	14	33068904	missense	probably benign	0.01
IGL03398:Wdfy4	APN	14	33047290	missense	probably benign	0.14
dodgers	UTSW	14	32977106	nonsense	probably null
Dollar	UTSW	14	33020311	missense	probably damaging	1.00
Giants	UTSW	14	33070618	nonsense	probably null
gigantea	UTSW	14	32974154	critical splice donor site	probably null
kings_canyon	UTSW	14	33109519	nonsense	probably null
moro	UTSW	14	32964626	splice site	probably null
popped	UTSW	14	32966399	missense	probably damaging	0.99
sequoia	UTSW	14	33100903	critical splice donor site	probably null
Sherman	UTSW	14	33095951	missense	possibly damaging	0.89
stretched	UTSW	14	33073535	nonsense	probably null
watchtower	UTSW	14	33083639	critical splice donor site	probably null
R0014:Wdfy4	UTSW	14	33107173	missense	possibly damaging	0.72
R0067:Wdfy4	UTSW	14	33162751	missense	probably null	1.00
R0085:Wdfy4	UTSW	14	33078243	missense	possibly damaging	0.81
R0277:Wdfy4	UTSW	14	33083785	missense	possibly damaging	0.83
R0436:Wdfy4	UTSW	14	33083812	splice site	probably benign
R0496:Wdfy4	UTSW	14	33140738	splice site	probably benign
R0514:Wdfy4	UTSW	14	33080775	missense	probably benign	0.22
R0548:Wdfy4	UTSW	14	33042621	missense	probably benign
R0590:Wdfy4	UTSW	14	33041174	missense	probably benign	0.09
R0647:Wdfy4	UTSW	14	33109699	missense	possibly damaging	0.96
R0766:Wdfy4	UTSW	14	33140612	missense	probably damaging	1.00
R0981:Wdfy4	UTSW	14	33147092	missense	probably benign	0.03
R1024:Wdfy4	UTSW	14	33079966	missense	possibly damaging	0.81
R1113:Wdfy4	UTSW	14	32971738	missense	possibly damaging	0.47
R1252:Wdfy4	UTSW	14	32971772	splice site	probably null
R1415:Wdfy4	UTSW	14	33041180	missense	possibly damaging	0.60
R1475:Wdfy4	UTSW	14	33108688	missense	probably benign	0.14
R1483:Wdfy4	UTSW	14	33100966	missense	probably benign	0.41
R1490:Wdfy4	UTSW	14	33152538	critical splice donor site	probably null
R1512:Wdfy4	UTSW	14	32960808	missense	probably damaging	0.98
R1615:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R1628:Wdfy4	UTSW	14	32959961	missense	probably damaging	1.00
R1643:Wdfy4	UTSW	14	33073585	critical splice acceptor site	probably null
R1729:Wdfy4	UTSW	14	33096005	missense	possibly damaging	0.85
R1859:Wdfy4	UTSW	14	33103983	missense	probably damaging	0.99
R1933:Wdfy4	UTSW	14	33133344	missense	probably benign	0.08
R1957:Wdfy4	UTSW	14	32971684	missense	probably damaging	1.00
R1968:Wdfy4	UTSW	14	33106044	missense	possibly damaging	0.95
R2032:Wdfy4	UTSW	14	33146989	missense	probably benign	0.11
R2241:Wdfy4	UTSW	14	33073511	missense	possibly damaging	0.81
R2391:Wdfy4	UTSW	14	33162807	missense	possibly damaging	0.92
R2888:Wdfy4	UTSW	14	33109519	nonsense	probably null
R2889:Wdfy4	UTSW	14	33109519	nonsense	probably null
R3114:Wdfy4	UTSW	14	33089903	missense	probably damaging	0.97
R3757:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3758:Wdfy4	UTSW	14	33023374	missense	probably benign	0.17
R3797:Wdfy4	UTSW	14	33140645	missense	probably damaging	1.00
R3890:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3892:Wdfy4	UTSW	14	33047280	missense	probably damaging	1.00
R3945:Wdfy4	UTSW	14	32966395	missense	probably damaging	0.99
R4011:Wdfy4	UTSW	14	33102680	splice site	probably benign
R4091:Wdfy4	UTSW	14	33125880	missense	possibly damaging	0.93
R4449:Wdfy4	UTSW	14	33096083	missense	probably damaging	1.00
R4585:Wdfy4	UTSW	14	33087955	missense	possibly damaging	0.89
R4628:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4629:Wdfy4	UTSW	14	33102558	missense	probably damaging	0.97
R4655:Wdfy4	UTSW	14	32989936	missense	probably damaging	0.98
R4689:Wdfy4	UTSW	14	33109548	missense	possibly damaging	0.88
R4718:Wdfy4	UTSW	14	33145316	missense	probably benign	0.03
R4862:Wdfy4	UTSW	14	33100903	critical splice donor site	probably null
R4884:Wdfy4	UTSW	14	32988895	nonsense	probably null
R4894:Wdfy4	UTSW	14	33155760	missense	probably benign	0.03
R4929:Wdfy4	UTSW	14	33047256	missense	possibly damaging	0.90
R4932:Wdfy4	UTSW	14	33029013	missense	probably damaging	1.00
R5014:Wdfy4	UTSW	14	33100940	missense	probably benign	0.02
R5020:Wdfy4	UTSW	14	33079935	missense	probably damaging	1.00
R5049:Wdfy4	UTSW	14	33152670	missense	possibly damaging	0.78
R5276:Wdfy4	UTSW	14	33047275	missense	probably damaging	1.00
R5318:Wdfy4	UTSW	14	33078343	missense	possibly damaging	0.95
R5338:Wdfy4	UTSW	14	33090866	missense	probably damaging	1.00
R5349:Wdfy4	UTSW	14	32988899	missense	probably damaging	1.00
R5411:Wdfy4	UTSW	14	32960002	missense	probably damaging	1.00
R5435:Wdfy4	UTSW	14	33020311	missense	probably damaging	1.00
R5463:Wdfy4	UTSW	14	33151732	missense	probably benign	0.17
R5591:Wdfy4	UTSW	14	33107130	missense	probably benign	0.09
R5598:Wdfy4	UTSW	14	33133497	missense	probably damaging	1.00
R5654:Wdfy4	UTSW	14	33107618	splice site	probably null
R5890:Wdfy4	UTSW	14	33102577	missense	possibly damaging	0.91
R5894:Wdfy4	UTSW	14	33133360	missense	possibly damaging	0.86
R5964:Wdfy4	UTSW	14	33106011	missense	probably damaging	1.00
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6036:Wdfy4	UTSW	14	33146990	missense	probably damaging	0.97
R6074:Wdfy4	UTSW	14	33083639	critical splice donor site	probably null
R6135:Wdfy4	UTSW	14	32971711	missense	probably damaging	0.99
R6276:Wdfy4	UTSW	14	33109525	missense	possibly damaging	0.54
R6357:Wdfy4	UTSW	14	33101049	nonsense	probably null
R6370:Wdfy4	UTSW	14	33068850	missense	probably benign	0.16
R6390:Wdfy4	UTSW	14	33104094	missense	probably damaging	0.99
R6413:Wdfy4	UTSW	14	32967647	missense	probably damaging	1.00
R6450:Wdfy4	UTSW	14	33108692	missense	probably damaging	1.00
R6522:Wdfy4	UTSW	14	33146944	missense	probably damaging	0.98
R6657:Wdfy4	UTSW	14	33047251	missense	possibly damaging	0.70
R6761:Wdfy4	UTSW	14	33095951	missense	possibly damaging	0.89
R6763:Wdfy4	UTSW	14	33042512	missense	probably damaging	1.00
R6952:Wdfy4	UTSW	14	32959966	missense	probably damaging	1.00
R6985:Wdfy4	UTSW	14	33099117	missense	possibly damaging	0.68
R7024:Wdfy4	UTSW	14	32964626	splice site	probably null
R7101:Wdfy4	UTSW	14	32960820	missense
R7114:Wdfy4	UTSW	14	32971574	splice site	probably null
R7139:Wdfy4	UTSW	14	33151578	missense
R7255:Wdfy4	UTSW	14	32974282	missense
R7324:Wdfy4	UTSW	14	33047314	missense
R7379:Wdfy4	UTSW	14	33151609	missense
R7399:Wdfy4	UTSW	14	33068906	missense
R7408:Wdfy4	UTSW	14	33078307	missense
R7410:Wdfy4	UTSW	14	32974234	missense
R7411:Wdfy4	UTSW	14	33106131	missense
R7412:Wdfy4	UTSW	14	33149584	missense
R7445:Wdfy4	UTSW	14	33070618	nonsense	probably null
R7595:Wdfy4	UTSW	14	32974154	critical splice donor site	probably null
R7618:Wdfy4	UTSW	14	32985739	missense
R7622:Wdfy4	UTSW	14	33078274	missense
R7828:Wdfy4	UTSW	14	32988921	missense	possibly damaging	0.90
R7888:Wdfy4	UTSW	14	33090963	missense
R7946:Wdfy4	UTSW	14	33070748	missense
R7946:Wdfy4	UTSW	14	33104115	missense
R7986:Wdfy4	UTSW	14	33104115	missense
R7990:Wdfy4	UTSW	14	33097795	missense
R8001:Wdfy4	UTSW	14	32973535	critical splice donor site	probably null
R8010:Wdfy4	UTSW	14	32971627	missense
R8015:Wdfy4	UTSW	14	33107747	missense
R8032:Wdfy4	UTSW	14	33029086	nonsense	probably null
R8041:Wdfy4	UTSW	14	33154008	critical splice donor site	probably null
R8090:Wdfy4	UTSW	14	33104115	missense
R8092:Wdfy4	UTSW	14	33104115	missense
R8112:Wdfy4	UTSW	14	33104115	missense
R8114:Wdfy4	UTSW	14	33104115	missense
R8115:Wdfy4	UTSW	14	33104115	missense
R8117:Wdfy4	UTSW	14	32977106	nonsense	probably null
R8117:Wdfy4	UTSW	14	33104115	missense
R8118:Wdfy4	UTSW	14	33104115	missense
R8140:Wdfy4	UTSW	14	33142360	missense
R8155:Wdfy4	UTSW	14	33162819	missense
R8163:Wdfy4	UTSW	14	33151588	missense
R8293:Wdfy4	UTSW	14	32974261	missense
R8325:Wdfy4	UTSW	14	32967487	missense
R8353:Wdfy4	UTSW	14	32973624	missense	probably benign
R8370:Wdfy4	UTSW	14	33093251	missense
R8437:Wdfy4	UTSW	14	33076375	missense
R8497:Wdfy4	UTSW	14	32966399	missense	probably damaging	0.99
R8545:Wdfy4	UTSW	14	33078301	missense	probably benign	0.01
R8671:Wdfy4	UTSW	14	32971765	splice site	probably benign
R8708:Wdfy4	UTSW	14	32967532	missense
R8747:Wdfy4	UTSW	14	33152654	missense
R8794:Wdfy4	UTSW	14	33147092	missense	probably benign	0.03
R8846:Wdfy4	UTSW	14	33145148	missense
R8880:Wdfy4	UTSW	14	33073535	nonsense	probably null
R9109:Wdfy4	UTSW	14	33038747	splice site	probably null
R9131:Wdfy4	UTSW	14	33097850	missense
R9309:Wdfy4	UTSW	14	33095356	missense
R9349:Wdfy4	UTSW	14	33154039	missense
R9563:Wdfy4	UTSW	14	32970876	missense
R9587:Wdfy4	UTSW	14	33047273	nonsense	probably null
R9599:Wdfy4	UTSW	14	33133471	missense
R9670:Wdfy4	UTSW	14	33047262	missense
R9718:Wdfy4	UTSW	14	33125936	missense
R9742:Wdfy4	UTSW	14	33088030	missense
X0028:Wdfy4	UTSW	14	33080636	missense	probably benign
X0053:Wdfy4	UTSW	14	33162942	start codon destroyed	probably null	0.99
X0062:Wdfy4	UTSW	14	33107618	splice site	probably null
Z1177:Wdfy4	UTSW	14	33087985	missense

Predicted Primers

PCR Primer
(F):5'- TGAGAATCTGTAAGCAGCTCTG -3'
(R):5'- ACCCGCCTGCTGGATTTTAC -3'

Sequencing Primer
(F):5'- AGCCTGGGTGGGAACTG -3'
(R):5'- AAGGGCCATGCTGCATTC -3'

Posted On

2022-06-15