Incidental Mutation 'R9451:Ugt3a1'
ID 714280
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene Name UDP glycosyltransferases 3 family, polypeptide A1
Synonyms Ugt3a2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R9451 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 9335670-9370960 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9292158 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 97 (D97G)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861] [ENSMUST00000176878]
AlphaFold Q3UP75
Predicted Effect probably benign
Transcript: ENSMUST00000022861
AA Change: D97G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: D97G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176878
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 T A 10: 21,265,032 (GRCm39) S220T probably benign Het
Ankrd66 A G 17: 43,845,811 (GRCm39) V192A probably benign Het
Aoc1l3 A G 6: 48,965,774 (GRCm39) Y594C probably damaging Het
Atp1a2 A G 1: 172,103,494 (GRCm39) Y1009H probably benign Het
Bptf A C 11: 106,935,411 (GRCm39) M142R probably damaging Het
Brwd1 C T 16: 95,845,703 (GRCm39) R740Q probably damaging Het
C3 A G 17: 57,531,169 (GRCm39) M339T probably benign Het
Catsperg1 A G 7: 28,897,772 (GRCm39) probably null Het
Cep295nl T A 11: 118,224,446 (GRCm39) K133* probably null Het
Copg2 A T 6: 30,793,786 (GRCm39) probably benign Het
Coro7 A T 16: 4,488,402 (GRCm39) D89E probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Ddx54 G T 5: 120,765,209 (GRCm39) R826L probably damaging Het
Dlg4 G T 11: 69,922,065 (GRCm39) K162N probably damaging Het
Dna2 T A 10: 62,790,072 (GRCm39) L185H probably benign Het
Dock9 C T 14: 121,787,601 (GRCm39) probably benign Het
Efcab8 G C 2: 153,646,861 (GRCm39) V397L unknown Het
Etl4 A G 2: 20,813,926 (GRCm39) I1322V probably benign Het
Exd1 T C 2: 119,355,064 (GRCm39) K284E possibly damaging Het
Flnc A G 6: 29,445,462 (GRCm39) T786A probably damaging Het
Gm29106 A C 1: 118,127,644 (GRCm39) E445D possibly damaging Het
Gm5592 T C 7: 40,935,876 (GRCm39) L126P probably damaging Het
Grep1 A G 17: 23,936,187 (GRCm39) Y19H unknown Het
Gtf3c2 T G 5: 31,325,773 (GRCm39) T389P probably damaging Het
Hhipl1 C A 12: 108,294,100 (GRCm39) R669S probably benign Het
Hivep1 A G 13: 42,337,252 (GRCm39) T2444A probably benign Het
Hspg2 A G 4: 137,238,380 (GRCm39) E289G probably damaging Het
Htatip2 C A 7: 49,408,987 (GRCm39) T9K unknown Het
Ifngr1 T C 10: 19,483,041 (GRCm39) V265A possibly damaging Het
Ift140 A G 17: 25,252,925 (GRCm39) N359D probably benign Het
Mat1a A G 14: 40,836,803 (GRCm39) R178G probably damaging Het
Mknk2 C T 10: 80,505,496 (GRCm39) R154H probably benign Het
Myh14 C T 7: 44,273,743 (GRCm39) probably null Het
Myof A G 19: 37,966,096 (GRCm39) probably null Het
Nfe2l1 G T 11: 96,718,453 (GRCm39) D27E probably damaging Het
Or1ad6 A G 11: 50,859,950 (GRCm39) Y35C Het
Or4a15 A T 2: 89,193,243 (GRCm39) C177S probably damaging Het
Or4k51 T C 2: 111,585,218 (GRCm39) V208A probably benign Het
Or5p61 A G 7: 107,758,468 (GRCm39) V204A probably benign Het
Or8s5 A G 15: 98,238,144 (GRCm39) V242A possibly damaging Het
Plec C A 15: 76,067,987 (GRCm39) Q1139H unknown Het
Plxna2 T A 1: 194,326,692 (GRCm39) S209T probably benign Het
Plxnd1 T C 6: 115,940,277 (GRCm39) E1369G possibly damaging Het
Psd3 T C 8: 68,363,487 (GRCm39) I3V unknown Het
Pwp1 T A 10: 85,714,428 (GRCm39) F195L probably damaging Het
Rab3ip C T 10: 116,775,354 (GRCm39) M1I probably null Het
Rad54l2 T C 9: 106,585,488 (GRCm39) K759R probably benign Het
Rims2 G T 15: 39,300,724 (GRCm39) V344L probably damaging Het
Robo1 G A 16: 72,803,718 (GRCm39) R1088Q probably benign Het
Rtf2 A G 2: 172,282,745 (GRCm39) probably benign Het
Serhl A C 15: 82,987,167 (GRCm39) K131N possibly damaging Het
Sidt1 T A 16: 44,075,392 (GRCm39) probably null Het
Slc27a1 T A 8: 72,032,808 (GRCm39) Y248* probably null Het
Slitrk3 T A 3: 72,958,616 (GRCm39) E52V possibly damaging Het
Snx2 T C 18: 53,343,415 (GRCm39) V271A probably benign Het
Snx9 C A 17: 5,949,768 (GRCm39) P156Q probably damaging Het
Spag6 C A 2: 18,715,369 (GRCm39) Y71* probably null Het
Speer4a3 T A 5: 26,156,569 (GRCm39) K137* probably null Het
Speg A G 1: 75,394,377 (GRCm39) D1724G probably damaging Het
Syt7 A G 19: 10,421,532 (GRCm39) N572S probably damaging Het
Thoc2l C A 5: 104,668,644 (GRCm39) S1055R probably benign Het
Ticam2 A G 18: 46,693,766 (GRCm39) I107T probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem268 G A 4: 63,488,256 (GRCm39) V135M probably benign Het
Toporsl A G 4: 52,611,663 (GRCm39) T519A possibly damaging Het
Trim43b G A 9: 88,973,608 (GRCm39) L42F possibly damaging Het
Ttf2 A C 3: 100,852,089 (GRCm39) V1019G probably damaging Het
Uncx A G 5: 139,532,475 (GRCm39) N180S probably damaging Het
Vmn2r23 A G 6: 123,710,352 (GRCm39) T552A probably damaging Het
Vmn2r51 A T 7: 9,833,816 (GRCm39) H407Q probably damaging Het
Wdfy4 C T 14: 32,855,518 (GRCm39) E699K Het
Wdr95 A G 5: 149,504,165 (GRCm39) T324A probably benign Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9,310,698 (GRCm39) missense probably damaging 1.00
IGL01109:Ugt3a1 APN 15 9,367,354 (GRCm39) missense probably damaging 0.99
IGL01131:Ugt3a1 APN 15 9,365,248 (GRCm39) missense probably damaging 1.00
IGL01627:Ugt3a1 APN 15 9,335,806 (GRCm39) missense probably damaging 1.00
IGL01746:Ugt3a1 APN 15 9,361,754 (GRCm39) missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9,306,232 (GRCm39) missense probably damaging 1.00
IGL01949:Ugt3a1 APN 15 9,335,815 (GRCm39) missense probably damaging 1.00
IGL02213:Ugt3a1 APN 15 9,370,310 (GRCm39) missense probably benign 0.00
IGL02407:Ugt3a1 APN 15 9,365,316 (GRCm39) nonsense probably null
IGL02438:Ugt3a1 APN 15 9,292,062 (GRCm39) missense possibly damaging 0.90
IGL02588:Ugt3a1 APN 15 9,361,542 (GRCm39) missense probably benign
IGL02894:Ugt3a1 APN 15 9,367,487 (GRCm39) missense probably damaging 1.00
IGL02966:Ugt3a1 APN 15 9,370,154 (GRCm39) missense probably damaging 1.00
IGL03385:Ugt3a1 APN 15 9,338,824 (GRCm39) missense probably damaging 0.99
IGL03493:Ugt3a1 APN 15 9,361,569 (GRCm39) missense probably damaging 0.96
PIT4354001:Ugt3a1 UTSW 15 9,306,446 (GRCm39) nonsense probably null
R0127:Ugt3a1 UTSW 15 9,306,342 (GRCm39) missense probably benign 0.01
R0554:Ugt3a1 UTSW 15 9,351,206 (GRCm39) missense probably benign 0.14
R0647:Ugt3a1 UTSW 15 9,310,635 (GRCm39) missense probably benign 0.00
R0833:Ugt3a1 UTSW 15 9,370,236 (GRCm39) missense probably damaging 0.96
R0841:Ugt3a1 UTSW 15 9,306,214 (GRCm39) missense probably benign 0.07
R1071:Ugt3a1 UTSW 15 9,367,454 (GRCm39) missense possibly damaging 0.82
R1395:Ugt3a1 UTSW 15 9,306,378 (GRCm39) missense possibly damaging 0.92
R1513:Ugt3a1 UTSW 15 9,361,610 (GRCm39) missense probably benign 0.07
R1616:Ugt3a1 UTSW 15 9,306,330 (GRCm39) nonsense probably null
R1844:Ugt3a1 UTSW 15 9,351,254 (GRCm39) missense probably benign 0.07
R1874:Ugt3a1 UTSW 15 9,365,437 (GRCm39) missense probably damaging 1.00
R2305:Ugt3a1 UTSW 15 9,351,203 (GRCm39) missense probably benign
R2338:Ugt3a1 UTSW 15 9,292,059 (GRCm39) splice site probably benign
R3052:Ugt3a1 UTSW 15 9,365,374 (GRCm39) missense probably damaging 1.00
R3755:Ugt3a1 UTSW 15 9,367,498 (GRCm39) missense probably benign 0.21
R3797:Ugt3a1 UTSW 15 9,310,727 (GRCm39) nonsense probably null
R3945:Ugt3a1 UTSW 15 9,370,184 (GRCm39) missense possibly damaging 0.91
R4135:Ugt3a1 UTSW 15 9,338,810 (GRCm39) missense probably damaging 0.98
R4261:Ugt3a1 UTSW 15 9,335,879 (GRCm39) splice site probably null
R4305:Ugt3a1 UTSW 15 9,306,360 (GRCm39) missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9,306,565 (GRCm39) missense probably benign 0.15
R4438:Ugt3a1 UTSW 15 9,351,283 (GRCm39) missense probably benign 0.01
R4570:Ugt3a1 UTSW 15 9,338,807 (GRCm39) missense probably benign 0.12
R4572:Ugt3a1 UTSW 15 9,306,479 (GRCm39) missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9,306,486 (GRCm39) nonsense probably null
R4744:Ugt3a1 UTSW 15 9,310,639 (GRCm39) missense probably benign 0.36
R4791:Ugt3a1 UTSW 15 9,361,665 (GRCm39) missense probably damaging 1.00
R4957:Ugt3a1 UTSW 15 9,365,274 (GRCm39) missense probably benign 0.27
R5011:Ugt3a1 UTSW 15 9,365,373 (GRCm39) missense probably damaging 1.00
R5035:Ugt3a1 UTSW 15 9,361,704 (GRCm39) missense probably benign 0.01
R5554:Ugt3a1 UTSW 15 9,370,287 (GRCm39) missense probably damaging 1.00
R5573:Ugt3a1 UTSW 15 9,361,769 (GRCm39) missense probably damaging 1.00
R5631:Ugt3a1 UTSW 15 9,361,971 (GRCm39) missense probably damaging 0.98
R5696:Ugt3a1 UTSW 15 9,361,534 (GRCm39) splice site silent
R5715:Ugt3a1 UTSW 15 9,306,430 (GRCm39) missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9,306,172 (GRCm39) missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9,306,172 (GRCm39) missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9,310,762 (GRCm39) missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9,310,726 (GRCm39) missense possibly damaging 0.81
R6265:Ugt3a1 UTSW 15 9,361,665 (GRCm39) missense probably damaging 1.00
R6302:Ugt3a1 UTSW 15 9,365,397 (GRCm39) missense probably damaging 1.00
R6311:Ugt3a1 UTSW 15 9,361,604 (GRCm39) nonsense probably null
R6344:Ugt3a1 UTSW 15 9,306,317 (GRCm39) missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9,306,541 (GRCm39) missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9,306,541 (GRCm39) missense probably benign 0.00
R6680:Ugt3a1 UTSW 15 9,370,154 (GRCm39) missense probably damaging 1.00
R6737:Ugt3a1 UTSW 15 9,311,895 (GRCm39) missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9,280,138 (GRCm39) splice site probably null
R6937:Ugt3a1 UTSW 15 9,292,158 (GRCm39) missense probably benign 0.00
R7061:Ugt3a1 UTSW 15 9,306,240 (GRCm39) missense probably benign 0.12
R7672:Ugt3a1 UTSW 15 9,310,779 (GRCm39) nonsense probably null
R7840:Ugt3a1 UTSW 15 9,311,903 (GRCm39) missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9,284,261 (GRCm39) critical splice donor site probably null
R8105:Ugt3a1 UTSW 15 9,306,476 (GRCm39) missense probably benign 0.00
R8229:Ugt3a1 UTSW 15 9,367,463 (GRCm39) missense probably damaging 0.99
R8296:Ugt3a1 UTSW 15 9,362,024 (GRCm39) missense probably benign 0.18
R8414:Ugt3a1 UTSW 15 9,310,669 (GRCm39) missense possibly damaging 0.82
R8809:Ugt3a1 UTSW 15 9,367,345 (GRCm39) missense possibly damaging 0.69
R8981:Ugt3a1 UTSW 15 9,312,014 (GRCm39) missense probably benign 0.20
R9066:Ugt3a1 UTSW 15 9,367,384 (GRCm39) missense possibly damaging 0.94
R9071:Ugt3a1 UTSW 15 9,370,224 (GRCm39) nonsense probably null
R9111:Ugt3a1 UTSW 15 9,306,333 (GRCm39) missense possibly damaging 0.69
R9151:Ugt3a1 UTSW 15 9,362,051 (GRCm39) missense probably benign 0.03
R9522:Ugt3a1 UTSW 15 9,370,209 (GRCm39) missense probably damaging 1.00
R9567:Ugt3a1 UTSW 15 9,306,370 (GRCm39) missense possibly damaging 0.82
R9609:Ugt3a1 UTSW 15 9,361,905 (GRCm39) missense probably damaging 1.00
R9657:Ugt3a1 UTSW 15 9,280,133 (GRCm39) missense probably damaging 0.98
Z1177:Ugt3a1 UTSW 15 9,367,343 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGTAGCTATGTCTTTACATGAAAGG -3'
(R):5'- TATCTAGGTATGAGTCAACTACCATGC -3'

Sequencing Primer
(F):5'- TTCCACAAAGAGGAGACATTAATTG -3'
(R):5'- GTATGAGTCAACTACCATGCACAATC -3'
Posted On 2022-06-15