Incidental Mutation 'R9451:Ugt3a1'
ID 714280
Institutional Source Beutler Lab
Gene Symbol Ugt3a1
Ensembl Gene ENSMUSG00000072664
Gene Name UDP glycosyltransferases 3 family, polypeptide A1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R9451 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 9276888-9315032 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9292072 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 97 (D97G)
Ref Sequence ENSEMBL: ENSMUSP00000022861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022861] [ENSMUST00000176878]
AlphaFold Q3UP75
Predicted Effect probably benign
Transcript: ENSMUST00000022861
AA Change: D97G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022861
Gene: ENSMUSG00000072664
AA Change: D97G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.4e-98 PFAM
Pfam:Glyco_tran_28_C 300 451 3.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176878
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,717,213 Y19H unknown Het
Aldh8a1 T A 10: 21,389,133 S220T probably benign Het
Ankrd66 A G 17: 43,534,920 V192A probably benign Het
Atp1a2 A G 1: 172,275,927 Y1009H probably benign Het
BC005561 C A 5: 104,520,778 S1055R probably benign Het
Bptf A C 11: 107,044,585 M142R probably damaging Het
Brwd1 C T 16: 96,044,503 R740Q probably damaging Het
C3 A G 17: 57,224,169 M339T probably benign Het
Catsperg1 A G 7: 29,198,347 probably null Het
Cep295nl T A 11: 118,333,620 K133* probably null Het
Copg2 A T 6: 30,816,851 probably benign Het
Coro7 A T 16: 4,670,538 D89E probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Ddx54 G T 5: 120,627,144 R826L probably damaging Het
Dlg4 G T 11: 70,031,239 K162N probably damaging Het
Dna2 T A 10: 62,954,293 L185H probably benign Het
Dock9 C T 14: 121,550,189 probably benign Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Etl4 A G 2: 20,809,115 I1322V probably benign Het
Exd1 T C 2: 119,524,583 K284E possibly damaging Het
Flnc A G 6: 29,445,463 T786A probably damaging Het
Gm21671 T A 5: 25,951,571 K137* probably null Het
Gm29106 A C 1: 118,199,914 E445D possibly damaging Het
Gm5592 T C 7: 41,286,452 L126P probably damaging Het
Gtf3c2 T G 5: 31,168,429 T389P probably damaging Het
Hhipl1 C A 12: 108,327,841 R669S probably benign Het
Hivep1 A G 13: 42,183,776 T2444A probably benign Het
Hspg2 A G 4: 137,511,069 E289G probably damaging Het
Htatip2 C A 7: 49,759,239 T9K unknown Het
Ifngr1 T C 10: 19,607,293 V265A possibly damaging Het
Ift140 A G 17: 25,033,951 N359D probably benign Het
Mat1a A G 14: 41,114,846 R178G probably damaging Het
Mknk2 C T 10: 80,669,662 R154H probably benign Het
Myh14 C T 7: 44,624,319 probably null Het
Myof A G 19: 37,977,648 probably null Het
Nfe2l1 G T 11: 96,827,627 D27E probably damaging Het
Olfr1234 A T 2: 89,362,899 C177S probably damaging Het
Olfr1301 T C 2: 111,754,873 V208A probably benign Het
Olfr1378 A G 11: 50,969,123 Y35C Het
Olfr284 A G 15: 98,340,263 V242A possibly damaging Het
Olfr485 A G 7: 108,159,261 V204A probably benign Het
Plec C A 15: 76,183,787 Q1139H unknown Het
Plxna2 T A 1: 194,644,384 S209T probably benign Het
Plxnd1 T C 6: 115,963,316 E1369G possibly damaging Het
Psd3 T C 8: 67,910,835 I3V unknown Het
Pwp1 T A 10: 85,878,564 F195L probably damaging Het
Rab3ip C T 10: 116,939,449 M1I probably null Het
Rad54l2 T C 9: 106,708,289 K759R probably benign Het
Rims2 G T 15: 39,437,328 V344L probably damaging Het
Robo1 G A 16: 73,006,830 R1088Q probably benign Het
Rtf2 A G 2: 172,440,825 probably benign Het
Serhl A C 15: 83,102,966 K131N possibly damaging Het
Sidt1 T A 16: 44,255,029 probably null Het
Slc27a1 T A 8: 71,580,164 Y248* probably null Het
Slitrk3 T A 3: 73,051,283 E52V possibly damaging Het
Snx2 T C 18: 53,210,343 V271A probably benign Het
Snx9 C A 17: 5,899,493 P156Q probably damaging Het
Spag6 C A 2: 18,710,558 Y71* probably null Het
Speg A G 1: 75,417,733 D1724G probably damaging Het
Svs1 A G 6: 48,988,840 Y594C probably damaging Het
Syt7 A G 19: 10,444,168 N572S probably damaging Het
Ticam2 A G 18: 46,560,699 I107T probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem268 G A 4: 63,570,019 V135M probably benign Het
Toporsl A G 4: 52,611,663 T519A possibly damaging Het
Trim43b G A 9: 89,091,555 L42F possibly damaging Het
Ttf2 A C 3: 100,944,773 V1019G probably damaging Het
Uncx A G 5: 139,546,720 N180S probably damaging Het
Vmn2r23 A G 6: 123,733,393 T552A probably damaging Het
Vmn2r51 A T 7: 10,099,889 H407Q probably damaging Het
Wdfy4 C T 14: 33,133,561 E699K Het
Wdr95 A G 5: 149,580,700 T324A probably benign Het
Other mutations in Ugt3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Ugt3a1 APN 15 9310612 missense probably damaging 1.00
IGL01752:Ugt3a1 APN 15 9306146 missense probably damaging 1.00
IGL02438:Ugt3a1 APN 15 9291976 missense possibly damaging 0.90
PIT4354001:Ugt3a1 UTSW 15 9306360 nonsense probably null
R0127:Ugt3a1 UTSW 15 9306256 missense probably benign 0.01
R0647:Ugt3a1 UTSW 15 9310549 missense probably benign 0.00
R0841:Ugt3a1 UTSW 15 9306128 missense probably benign 0.07
R1395:Ugt3a1 UTSW 15 9306292 missense possibly damaging 0.92
R1616:Ugt3a1 UTSW 15 9306244 nonsense probably null
R2338:Ugt3a1 UTSW 15 9291973 splice site probably benign
R3797:Ugt3a1 UTSW 15 9310641 nonsense probably null
R4305:Ugt3a1 UTSW 15 9306274 missense possibly damaging 0.92
R4385:Ugt3a1 UTSW 15 9306479 missense probably benign 0.15
R4572:Ugt3a1 UTSW 15 9306393 missense probably benign 0.00
R4611:Ugt3a1 UTSW 15 9306400 nonsense probably null
R4744:Ugt3a1 UTSW 15 9310553 missense probably benign 0.36
R5715:Ugt3a1 UTSW 15 9306344 missense probably damaging 0.96
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6036:Ugt3a1 UTSW 15 9306086 missense probably benign 0.01
R6156:Ugt3a1 UTSW 15 9310676 missense possibly damaging 0.83
R6228:Ugt3a1 UTSW 15 9310640 missense possibly damaging 0.81
R6344:Ugt3a1 UTSW 15 9306231 missense probably damaging 0.98
R6380:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6383:Ugt3a1 UTSW 15 9306455 missense probably benign 0.00
R6737:Ugt3a1 UTSW 15 9311809 missense probably benign 0.30
R6848:Ugt3a1 UTSW 15 9280052 splice site probably null
R6937:Ugt3a1 UTSW 15 9292072 missense probably benign 0.00
R7061:Ugt3a1 UTSW 15 9306154 missense probably benign 0.12
R7672:Ugt3a1 UTSW 15 9310693 nonsense probably null
R7840:Ugt3a1 UTSW 15 9311817 missense probably damaging 1.00
R7945:Ugt3a1 UTSW 15 9284175 critical splice donor site probably null
R8105:Ugt3a1 UTSW 15 9306390 missense probably benign 0.00
R8414:Ugt3a1 UTSW 15 9310583 missense possibly damaging 0.82
R8981:Ugt3a1 UTSW 15 9311928 missense probably benign 0.20
R9111:Ugt3a1 UTSW 15 9306247 missense possibly damaging 0.69
R9567:Ugt3a1 UTSW 15 9306284 missense possibly damaging 0.82
R9657:Ugt3a1 UTSW 15 9280047 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTAGCTATGTCTTTACATGAAAGG -3'
(R):5'- TATCTAGGTATGAGTCAACTACCATGC -3'

Sequencing Primer
(F):5'- TTCCACAAAGAGGAGACATTAATTG -3'
(R):5'- GTATGAGTCAACTACCATGCACAATC -3'
Posted On 2022-06-15