Incidental Mutation 'R9451:Ift140'
ID 714291
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Name intraflagellar transport 140
Synonyms Tce5, Wdtc2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9451 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25235056-25318461 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25252925 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 359 (N359D)
Ref Sequence ENSEMBL: ENSMUSP00000024983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386] [ENSMUST00000156945]
AlphaFold E9PY46
Predicted Effect probably benign
Transcript: ENSMUST00000024983
AA Change: N359D

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: N359D

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137386
AA Change: N359D

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: N359D

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000156945
AA Change: N90D

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116689
Gene: ENSMUSG00000024169
AA Change: N90D

DomainStartEndE-ValueType
Blast:WD40 2 35 6e-12 BLAST
SCOP:d1erja_ 19 131 5e-7 SMART
Blast:WD40 39 83 1e-24 BLAST
Blast:WD40 95 136 2e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 T A 10: 21,265,032 (GRCm39) S220T probably benign Het
Ankrd66 A G 17: 43,845,811 (GRCm39) V192A probably benign Het
Aoc1l3 A G 6: 48,965,774 (GRCm39) Y594C probably damaging Het
Atp1a2 A G 1: 172,103,494 (GRCm39) Y1009H probably benign Het
Bptf A C 11: 106,935,411 (GRCm39) M142R probably damaging Het
Brwd1 C T 16: 95,845,703 (GRCm39) R740Q probably damaging Het
C3 A G 17: 57,531,169 (GRCm39) M339T probably benign Het
Catsperg1 A G 7: 28,897,772 (GRCm39) probably null Het
Cep295nl T A 11: 118,224,446 (GRCm39) K133* probably null Het
Copg2 A T 6: 30,793,786 (GRCm39) probably benign Het
Coro7 A T 16: 4,488,402 (GRCm39) D89E probably damaging Het
Cyp2t4 G A 7: 26,854,717 (GRCm39) V66M possibly damaging Het
Ddx54 G T 5: 120,765,209 (GRCm39) R826L probably damaging Het
Dlg4 G T 11: 69,922,065 (GRCm39) K162N probably damaging Het
Dna2 T A 10: 62,790,072 (GRCm39) L185H probably benign Het
Dock9 C T 14: 121,787,601 (GRCm39) probably benign Het
Efcab8 G C 2: 153,646,861 (GRCm39) V397L unknown Het
Etl4 A G 2: 20,813,926 (GRCm39) I1322V probably benign Het
Exd1 T C 2: 119,355,064 (GRCm39) K284E possibly damaging Het
Flnc A G 6: 29,445,462 (GRCm39) T786A probably damaging Het
Gm29106 A C 1: 118,127,644 (GRCm39) E445D possibly damaging Het
Gm5592 T C 7: 40,935,876 (GRCm39) L126P probably damaging Het
Grep1 A G 17: 23,936,187 (GRCm39) Y19H unknown Het
Gtf3c2 T G 5: 31,325,773 (GRCm39) T389P probably damaging Het
Hhipl1 C A 12: 108,294,100 (GRCm39) R669S probably benign Het
Hivep1 A G 13: 42,337,252 (GRCm39) T2444A probably benign Het
Hspg2 A G 4: 137,238,380 (GRCm39) E289G probably damaging Het
Htatip2 C A 7: 49,408,987 (GRCm39) T9K unknown Het
Ifngr1 T C 10: 19,483,041 (GRCm39) V265A possibly damaging Het
Mat1a A G 14: 40,836,803 (GRCm39) R178G probably damaging Het
Mknk2 C T 10: 80,505,496 (GRCm39) R154H probably benign Het
Myh14 C T 7: 44,273,743 (GRCm39) probably null Het
Myof A G 19: 37,966,096 (GRCm39) probably null Het
Nfe2l1 G T 11: 96,718,453 (GRCm39) D27E probably damaging Het
Or1ad6 A G 11: 50,859,950 (GRCm39) Y35C Het
Or4a15 A T 2: 89,193,243 (GRCm39) C177S probably damaging Het
Or4k51 T C 2: 111,585,218 (GRCm39) V208A probably benign Het
Or5p61 A G 7: 107,758,468 (GRCm39) V204A probably benign Het
Or8s5 A G 15: 98,238,144 (GRCm39) V242A possibly damaging Het
Plec C A 15: 76,067,987 (GRCm39) Q1139H unknown Het
Plxna2 T A 1: 194,326,692 (GRCm39) S209T probably benign Het
Plxnd1 T C 6: 115,940,277 (GRCm39) E1369G possibly damaging Het
Psd3 T C 8: 68,363,487 (GRCm39) I3V unknown Het
Pwp1 T A 10: 85,714,428 (GRCm39) F195L probably damaging Het
Rab3ip C T 10: 116,775,354 (GRCm39) M1I probably null Het
Rad54l2 T C 9: 106,585,488 (GRCm39) K759R probably benign Het
Rims2 G T 15: 39,300,724 (GRCm39) V344L probably damaging Het
Robo1 G A 16: 72,803,718 (GRCm39) R1088Q probably benign Het
Rtf2 A G 2: 172,282,745 (GRCm39) probably benign Het
Serhl A C 15: 82,987,167 (GRCm39) K131N possibly damaging Het
Sidt1 T A 16: 44,075,392 (GRCm39) probably null Het
Slc27a1 T A 8: 72,032,808 (GRCm39) Y248* probably null Het
Slitrk3 T A 3: 72,958,616 (GRCm39) E52V possibly damaging Het
Snx2 T C 18: 53,343,415 (GRCm39) V271A probably benign Het
Snx9 C A 17: 5,949,768 (GRCm39) P156Q probably damaging Het
Spag6 C A 2: 18,715,369 (GRCm39) Y71* probably null Het
Speer4a3 T A 5: 26,156,569 (GRCm39) K137* probably null Het
Speg A G 1: 75,394,377 (GRCm39) D1724G probably damaging Het
Syt7 A G 19: 10,421,532 (GRCm39) N572S probably damaging Het
Thoc2l C A 5: 104,668,644 (GRCm39) S1055R probably benign Het
Ticam2 A G 18: 46,693,766 (GRCm39) I107T probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem268 G A 4: 63,488,256 (GRCm39) V135M probably benign Het
Toporsl A G 4: 52,611,663 (GRCm39) T519A possibly damaging Het
Trim43b G A 9: 88,973,608 (GRCm39) L42F possibly damaging Het
Ttf2 A C 3: 100,852,089 (GRCm39) V1019G probably damaging Het
Ugt3a1 A G 15: 9,292,158 (GRCm39) D97G probably benign Het
Uncx A G 5: 139,532,475 (GRCm39) N180S probably damaging Het
Vmn2r23 A G 6: 123,710,352 (GRCm39) T552A probably damaging Het
Vmn2r51 A T 7: 9,833,816 (GRCm39) H407Q probably damaging Het
Wdfy4 C T 14: 32,855,518 (GRCm39) E699K Het
Wdr95 A G 5: 149,504,165 (GRCm39) T324A probably benign Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25,274,618 (GRCm39) missense probably damaging 1.00
IGL00966:Ift140 APN 17 25,237,776 (GRCm39) missense probably damaging 1.00
IGL01082:Ift140 APN 17 25,267,429 (GRCm39) missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25,313,676 (GRCm39) missense probably benign 0.02
IGL01816:Ift140 APN 17 25,305,999 (GRCm39) splice site probably null
IGL01994:Ift140 APN 17 25,267,417 (GRCm39) missense probably damaging 1.00
IGL02102:Ift140 APN 17 25,252,104 (GRCm39) missense probably benign 0.03
IGL02207:Ift140 APN 17 25,274,572 (GRCm39) missense probably benign
IGL02493:Ift140 APN 17 25,306,898 (GRCm39) nonsense probably null
IGL02735:Ift140 APN 17 25,253,009 (GRCm39) splice site probably benign
IGL02902:Ift140 APN 17 25,309,736 (GRCm39) missense probably damaging 1.00
IGL03037:Ift140 APN 17 25,311,368 (GRCm39) missense probably benign 0.02
IGL03122:Ift140 APN 17 25,305,884 (GRCm39) missense probably damaging 1.00
IGL03206:Ift140 APN 17 25,311,800 (GRCm39) missense probably damaging 0.98
IGL03271:Ift140 APN 17 25,306,880 (GRCm39) missense probably damaging 1.00
IGL03358:Ift140 APN 17 25,306,958 (GRCm39) missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25,305,834 (GRCm39) missense probably damaging 0.98
R0100:Ift140 UTSW 17 25,309,928 (GRCm39) nonsense probably null
R0100:Ift140 UTSW 17 25,309,928 (GRCm39) nonsense probably null
R0197:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0238:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0238:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0239:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0239:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0355:Ift140 UTSW 17 25,267,409 (GRCm39) nonsense probably null
R0399:Ift140 UTSW 17 25,269,314 (GRCm39) missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25,270,734 (GRCm39) splice site probably null
R0610:Ift140 UTSW 17 25,254,777 (GRCm39) missense probably benign 0.06
R0701:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0883:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0900:Ift140 UTSW 17 25,254,786 (GRCm39) missense probably benign 0.22
R1167:Ift140 UTSW 17 25,254,719 (GRCm39) missense probably benign 0.01
R1295:Ift140 UTSW 17 25,307,907 (GRCm39) critical splice donor site probably null
R1588:Ift140 UTSW 17 25,306,959 (GRCm39) missense probably damaging 1.00
R1619:Ift140 UTSW 17 25,307,839 (GRCm39) missense probably damaging 1.00
R1637:Ift140 UTSW 17 25,244,608 (GRCm39) missense probably benign 0.40
R1854:Ift140 UTSW 17 25,254,813 (GRCm39) missense probably benign 0.05
R2397:Ift140 UTSW 17 25,239,710 (GRCm39) missense probably damaging 1.00
R2510:Ift140 UTSW 17 25,255,282 (GRCm39) missense probably benign 0.02
R2918:Ift140 UTSW 17 25,254,805 (GRCm39) missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25,255,282 (GRCm39) missense probably benign 0.02
R3878:Ift140 UTSW 17 25,247,918 (GRCm39) missense probably benign 0.25
R4559:Ift140 UTSW 17 25,309,741 (GRCm39) missense probably damaging 0.97
R4670:Ift140 UTSW 17 25,317,935 (GRCm39) unclassified probably benign
R4711:Ift140 UTSW 17 25,313,691 (GRCm39) splice site probably null
R4934:Ift140 UTSW 17 25,267,462 (GRCm39) missense probably benign
R4949:Ift140 UTSW 17 25,313,639 (GRCm39) missense probably benign 0.06
R4982:Ift140 UTSW 17 25,255,968 (GRCm39) missense probably damaging 0.99
R5099:Ift140 UTSW 17 25,309,674 (GRCm39) missense probably damaging 1.00
R5223:Ift140 UTSW 17 25,254,786 (GRCm39) missense probably benign 0.22
R5268:Ift140 UTSW 17 25,239,601 (GRCm39) missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25,252,059 (GRCm39) missense probably damaging 0.96
R5480:Ift140 UTSW 17 25,239,550 (GRCm39) missense probably damaging 1.00
R5655:Ift140 UTSW 17 25,264,038 (GRCm39) missense probably damaging 1.00
R5756:Ift140 UTSW 17 25,247,787 (GRCm39) missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25,308,514 (GRCm39) missense probably damaging 1.00
R5894:Ift140 UTSW 17 25,252,893 (GRCm39) missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25,311,345 (GRCm39) missense probably benign 0.02
R5966:Ift140 UTSW 17 25,313,735 (GRCm39) nonsense probably null
R6000:Ift140 UTSW 17 25,255,934 (GRCm39) missense probably benign 0.00
R6046:Ift140 UTSW 17 25,274,563 (GRCm39) missense probably benign 0.00
R6050:Ift140 UTSW 17 25,309,979 (GRCm39) missense probably damaging 1.00
R6103:Ift140 UTSW 17 25,312,100 (GRCm39) missense probably damaging 1.00
R6239:Ift140 UTSW 17 25,247,946 (GRCm39) missense probably benign 0.26
R6287:Ift140 UTSW 17 25,269,408 (GRCm39) missense probably benign
R6539:Ift140 UTSW 17 25,313,643 (GRCm39) missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25,251,147 (GRCm39) missense probably damaging 0.96
R6723:Ift140 UTSW 17 25,252,090 (GRCm39) missense probably benign 0.08
R6749:Ift140 UTSW 17 25,317,890 (GRCm39) missense probably damaging 0.99
R6892:Ift140 UTSW 17 25,239,520 (GRCm39) missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25,274,699 (GRCm39) missense probably damaging 1.00
R7235:Ift140 UTSW 17 25,239,619 (GRCm39) missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25,256,010 (GRCm39) missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25,252,089 (GRCm39) missense probably benign 0.02
R7560:Ift140 UTSW 17 25,311,315 (GRCm39) missense probably benign 0.28
R7660:Ift140 UTSW 17 25,270,798 (GRCm39) missense probably damaging 1.00
R8105:Ift140 UTSW 17 25,255,949 (GRCm39) missense probably benign 0.01
R8415:Ift140 UTSW 17 25,311,889 (GRCm39) missense probably damaging 0.99
R8437:Ift140 UTSW 17 25,313,651 (GRCm39) missense probably damaging 0.99
R8747:Ift140 UTSW 17 25,254,809 (GRCm39) missense probably benign
R8932:Ift140 UTSW 17 25,305,862 (GRCm39) missense probably benign 0.03
R9226:Ift140 UTSW 17 25,317,839 (GRCm39) missense probably benign 0.00
R9347:Ift140 UTSW 17 25,313,753 (GRCm39) missense probably benign 0.00
R9456:Ift140 UTSW 17 25,254,758 (GRCm39) missense probably benign 0.03
R9782:Ift140 UTSW 17 25,264,151 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TATACACATGCCGACACCATGG -3'
(R):5'- GACCTACACTGAGTAACTGATAAGAC -3'

Sequencing Primer
(F):5'- TTAGGAGATGAACCAGATCGCCAC -3'
(R):5'- GTAACTGATAAGACTATGTTCCAAGC -3'
Posted On 2022-06-15