Mutagenetix > Incidental Mutation

Incidental Mutation 'R9452:Pirb'

714329

Institutional Source

Beutler Lab

Gene Symbol

Pirb

Ensembl Gene

ENSMUSG00000058818

Gene Name

paired Ig-like receptor B

Synonyms

Lilrb3, Gp91

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9452 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3711409-3720391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 3717618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 294 (R294C)

Ref Sequence

ENSEMBL: ENSMUSP00000077546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078451]

AlphaFold

P97484

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078451
AA Change: R294C

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000077546
Gene: ENSMUSG00000058818
AA Change: R294C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	34	118	1.8e-3	SMART
IG	129	315	1.2e-4	SMART
IG_like	237	302	6.2e-4	SMART
IG_like	328	415	3.4e-2	SMART
IG_like	435	502	1e-2	SMART
IG	529	618	3.6e-5	SMART
low complexity region	624	637	N/A	INTRINSIC
transmembrane domain	641	663	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in both B and T lymphocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb8	A	G	5: 24,407,384	Y564C	probably null	Het
Ablim2	A	T	5: 35,857,854	D470V	probably benign	Het
Actr10	T	C	12: 70,960,044		probably null	Het
Adam4	T	A	12: 81,420,297	I517L	probably benign	Het
Ank1	C	A	8: 23,132,413	D1659E	probably benign	Het
Arnt2	A	G	7: 84,284,126	V308A	probably benign	Het
Avl9	T	C	6: 56,729,741	V184A	probably damaging	Het
Bag1	A	T	4: 40,947,733	I157N	probably benign	Het
BC005561	T	A	5: 104,521,744	N1377K	probably benign	Het
Bicc1	A	T	10: 70,957,151	D224E	probably damaging	Het
C2	T	G	17: 34,876,343	I209L	probably benign	Het
Cacna1e	A	T	1: 154,413,974		probably null	Het
Capn1	T	C	19: 6,007,257	Y387C	probably damaging	Het
Cebpa	A	G	7: 35,119,608	I64V	possibly damaging	Het
Celf4	T	G	18: 25,491,162	M436L	probably benign	Het
Cfb	C	A	17: 34,859,108	V436L	probably benign	Het
Ciart	C	T	3: 95,881,215	C104Y	probably benign	Het
Cmya5	A	G	13: 93,095,886	L898P	probably benign	Het
Cyp2c68	A	T	19: 39,699,389	M388K	possibly damaging	Het
Cypt12	T	C	3: 17,948,679	V72A	probably benign	Het
Dlec1	A	G	9: 119,112,473	D309G	probably benign	Het
Dnah1	A	G	14: 31,296,491	V1394A	probably benign	Het
Dpp3	A	C	19: 4,923,722	S108A	probably benign	Het
Eif5b	C	T	1: 38,045,780	P903S	probably damaging	Het
Erc2	A	G	14: 28,011,733	D580G	probably damaging	Het
Fam98c	A	G	7: 29,153,476	V44A	probably benign	Het
Fer	A	G	17: 63,924,072	K273E	probably benign	Het
Gm906	T	C	13: 50,246,772	H506R	possibly damaging	Het
Gm9268	A	T	7: 43,047,833	L771F	possibly damaging	Het
Gzme	T	A	14: 56,118,397	I153F	probably benign	Het
Ice1	A	T	13: 70,596,343	N2040K	probably damaging	Het
Ifi214	G	T	1: 173,529,328	Q70K	possibly damaging	Het
Itpripl1	C	A	2: 127,141,414	E263*	probably null	Het
Kat8	A	G	7: 127,925,249	K433R	probably benign	Het
Klra5	C	A	6: 129,906,723	W147L	possibly damaging	Het
Lefty1	A	T	1: 180,935,284	T59S	probably benign	Het
Lig3	C	T	11: 82,790,622	T481M	probably damaging	Het
Lrfn1	A	T	7: 28,459,732	I359F	probably damaging	Het
Lrp1b	A	T	2: 41,960,714	C90*	probably null	Het
Micall2	T	G	5: 139,717,556		probably null	Het
Mtmr3	G	T	11: 4,491,037	L539I	probably damaging	Het
Obscn	C	A	11: 59,034,136		probably null	Het
Olfml3	T	C	3: 103,736,259	T269A	probably benign	Het
Olfr1217	C	T	2: 89,023,890	G38R		Het
Oprl1	C	T	2: 181,718,661	A170V	possibly damaging	Het
Pdgfrb	G	A	18: 61,065,726	V319M	possibly damaging	Het
Piwil1	T	C	5: 128,747,893	S552P	probably benign	Het
Pkd2	T	C	5: 104,466,975	F228L	probably damaging	Het
Pkhd1	T	A	1: 20,612,729	D83V	possibly damaging	Het
Plcl1	A	G	1: 55,695,833	D111G	probably damaging	Het
Plpp2	A	G	10: 79,527,868	S162P	probably damaging	Het
Prex2	T	A	1: 11,185,927	I1174K	probably benign	Het
Prkdc	T	A	16: 15,667,601	Y431N	possibly damaging	Het
Pter	A	G	2: 12,980,300	D147G	probably benign	Het
Rbsn	T	C	6: 92,201,764	D134G	possibly damaging	Het
Rnf220	T	C	4: 117,296,142	D299G	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Scn2a	G	A	2: 65,764,819	S2004N	probably benign	Het
Slc7a4	T	A	16: 17,573,407	N593I	probably damaging	Het
Speg	T	C	1: 75,422,508	S2200P	probably benign	Het
Tle1	A	T	4: 72,122,359	H654Q	probably benign	Het
Ttll6	G	A	11: 96,135,762	R124H	probably damaging	Het
Vmn2r111	A	G	17: 22,559,151	C516R	probably damaging	Het
Vmn2r89	T	C	14: 51,455,831	S213P	probably damaging	Het
Washc4	A	G	10: 83,560,523	N399S	probably benign	Het
Wdr37	G	A	13: 8,847,627	H198Y		Het
Zfp407	A	G	18: 84,562,454	L178P	probably benign	Het
Zfp882	C	T	8: 71,914,987	H553Y	probably damaging	Het
Zfp956	T	C	6: 47,963,436	V243A	probably benign	Het

Other mutations in Pirb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01295:Pirb	APN	7	3717406	missense	probably damaging	0.99
IGL01744:Pirb	APN	7	3717176	nonsense	probably null
IGL01755:Pirb	APN	7	3717170	missense	probably benign	0.16
IGL02580:Pirb	APN	7	3714206	splice site	probably null
IGL02941:Pirb	APN	7	3717378	missense	probably damaging	1.00
R0394:Pirb	UTSW	7	3719248	missense	probably benign	0.08
R0680:Pirb	UTSW	7	3717361	missense	possibly damaging	0.94
R0787:Pirb	UTSW	7	3717638	missense	probably benign
R0790:Pirb	UTSW	7	3717638	missense	probably benign
R0832:Pirb	UTSW	7	3717638	missense	probably benign
R1124:Pirb	UTSW	7	3719732	missense	probably benign	0.02
R1178:Pirb	UTSW	7	3717638	missense	probably benign
R1180:Pirb	UTSW	7	3717638	missense	probably benign
R1181:Pirb	UTSW	7	3717638	missense	probably benign
R1281:Pirb	UTSW	7	3717190	missense	probably damaging	1.00
R1343:Pirb	UTSW	7	3717638	missense	probably benign
R1579:Pirb	UTSW	7	3717638	missense	probably benign
R1699:Pirb	UTSW	7	3717638	missense	probably benign
R1768:Pirb	UTSW	7	3717190	missense	probably damaging	1.00
R1909:Pirb	UTSW	7	3714588	missense	probably benign	0.33
R1965:Pirb	UTSW	7	3717638	missense	probably benign
R1966:Pirb	UTSW	7	3717638	missense	probably benign
R2004:Pirb	UTSW	7	3717638	missense	probably benign
R2305:Pirb	UTSW	7	3712991	missense	probably benign	0.00
R2931:Pirb	UTSW	7	3717206	missense	probably benign	0.08
R3858:Pirb	UTSW	7	3717663	missense	possibly damaging	0.54
R3928:Pirb	UTSW	7	3717638	missense	probably benign
R3938:Pirb	UTSW	7	3717638	missense	probably benign
R4119:Pirb	UTSW	7	3717575	missense	probably damaging	1.00
R4174:Pirb	UTSW	7	3716032	critical splice donor site	probably null
R4248:Pirb	UTSW	7	3719298	missense	probably damaging	1.00
R4827:Pirb	UTSW	7	3717603	missense	probably benign
R4828:Pirb	UTSW	7	3717603	missense	probably benign
R4829:Pirb	UTSW	7	3717603	missense	probably benign
R4830:Pirb	UTSW	7	3717603	missense	probably benign
R4870:Pirb	UTSW	7	3712662	missense	probably benign	0.00
R4909:Pirb	UTSW	7	3719362	nonsense	probably null
R5146:Pirb	UTSW	7	3712621	utr 3 prime	probably benign
R5244:Pirb	UTSW	7	3716063	missense	probably benign	0.32
R5323:Pirb	UTSW	7	3716599	missense	possibly damaging	0.85
R5921:Pirb	UTSW	7	3716694	nonsense	probably null
R6316:Pirb	UTSW	7	3717823	missense	probably damaging	1.00
R6502:Pirb	UTSW	7	3717393	missense	probably benign	0.00
R6811:Pirb	UTSW	7	3719642	missense	possibly damaging	0.91
R7216:Pirb	UTSW	7	3716274	missense	probably benign	0.00
R7275:Pirb	UTSW	7	3716178	missense	probably benign	0.00
R7327:Pirb	UTSW	7	3717188	nonsense	probably null
R7582:Pirb	UTSW	7	3713818	critical splice donor site	probably null
R7717:Pirb	UTSW	7	3717783	missense	not run
R7717:Pirb	UTSW	7	3717801	missense	not run
R7807:Pirb	UTSW	7	3719865	missense	possibly damaging	0.55
R7844:Pirb	UTSW	7	3719411	nonsense	probably null
R7947:Pirb	UTSW	7	3719858	missense	probably damaging	0.96
R8206:Pirb	UTSW	7	3712906	critical splice donor site	probably null
R8397:Pirb	UTSW	7	3716046	missense	probably damaging	1.00
R8774:Pirb	UTSW	7	3717729	missense	probably damaging	1.00
R8774-TAIL:Pirb	UTSW	7	3717729	missense	probably damaging	1.00
R9033:Pirb	UTSW	7	3717585	missense	probably benign
R9275:Pirb	UTSW	7	3716860	missense	probably benign
R9595:Pirb	UTSW	7	3719407	missense	possibly damaging	0.78
R9605:Pirb	UTSW	7	3717618	missense	possibly damaging	0.68
R9607:Pirb	UTSW	7	3717618	missense	possibly damaging	0.68
X0025:Pirb	UTSW	7	3717268	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGACAGCCTGGGTTCATAG -3'
(R):5'- TGTGATCACCTCCAAAAGAGC -3'

Sequencing Primer
(F):5'- ACAGCCTGGGTTCATAGTATTC -3'
(R):5'- TCCAAAAGAGCAATGACCATCTGG -3'

Posted On

2022-06-15