Incidental Mutation 'R9452:Vmn2r111'
ID 714359
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R9452 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22547941-22573273 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22559151 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 516 (C516R)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect probably damaging
Transcript: ENSMUST00000092491
AA Change: C516R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: C516R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 A G 5: 24,407,384 Y564C probably null Het
Ablim2 A T 5: 35,857,854 D470V probably benign Het
Actr10 T C 12: 70,960,044 probably null Het
Adam4 T A 12: 81,420,297 I517L probably benign Het
Ank1 C A 8: 23,132,413 D1659E probably benign Het
Arnt2 A G 7: 84,284,126 V308A probably benign Het
Avl9 T C 6: 56,729,741 V184A probably damaging Het
Bag1 A T 4: 40,947,733 I157N probably benign Het
BC005561 T A 5: 104,521,744 N1377K probably benign Het
Bicc1 A T 10: 70,957,151 D224E probably damaging Het
C2 T G 17: 34,876,343 I209L probably benign Het
Cacna1e A T 1: 154,413,974 probably null Het
Capn1 T C 19: 6,007,257 Y387C probably damaging Het
Cebpa A G 7: 35,119,608 I64V possibly damaging Het
Celf4 T G 18: 25,491,162 M436L probably benign Het
Cfb C A 17: 34,859,108 V436L probably benign Het
Ciart C T 3: 95,881,215 C104Y probably benign Het
Cmya5 A G 13: 93,095,886 L898P probably benign Het
Cyp2c68 A T 19: 39,699,389 M388K possibly damaging Het
Cypt12 T C 3: 17,948,679 V72A probably benign Het
Dlec1 A G 9: 119,112,473 D309G probably benign Het
Dnah1 A G 14: 31,296,491 V1394A probably benign Het
Dpp3 A C 19: 4,923,722 S108A probably benign Het
Eif5b C T 1: 38,045,780 P903S probably damaging Het
Erc2 A G 14: 28,011,733 D580G probably damaging Het
Fam98c A G 7: 29,153,476 V44A probably benign Het
Fer A G 17: 63,924,072 K273E probably benign Het
Gm906 T C 13: 50,246,772 H506R possibly damaging Het
Gm9268 A T 7: 43,047,833 L771F possibly damaging Het
Gzme T A 14: 56,118,397 I153F probably benign Het
Ice1 A T 13: 70,596,343 N2040K probably damaging Het
Ifi214 G T 1: 173,529,328 Q70K possibly damaging Het
Itpripl1 C A 2: 127,141,414 E263* probably null Het
Kat8 A G 7: 127,925,249 K433R probably benign Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lefty1 A T 1: 180,935,284 T59S probably benign Het
Lig3 C T 11: 82,790,622 T481M probably damaging Het
Lrfn1 A T 7: 28,459,732 I359F probably damaging Het
Lrp1b A T 2: 41,960,714 C90* probably null Het
Micall2 T G 5: 139,717,556 probably null Het
Mtmr3 G T 11: 4,491,037 L539I probably damaging Het
Obscn C A 11: 59,034,136 probably null Het
Olfml3 T C 3: 103,736,259 T269A probably benign Het
Olfr1217 C T 2: 89,023,890 G38R Het
Oprl1 C T 2: 181,718,661 A170V possibly damaging Het
Pdgfrb G A 18: 61,065,726 V319M possibly damaging Het
Pirb G A 7: 3,717,618 R294C possibly damaging Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Pkd2 T C 5: 104,466,975 F228L probably damaging Het
Pkhd1 T A 1: 20,612,729 D83V possibly damaging Het
Plcl1 A G 1: 55,695,833 D111G probably damaging Het
Plpp2 A G 10: 79,527,868 S162P probably damaging Het
Prex2 T A 1: 11,185,927 I1174K probably benign Het
Prkdc T A 16: 15,667,601 Y431N possibly damaging Het
Pter A G 2: 12,980,300 D147G probably benign Het
Rbsn T C 6: 92,201,764 D134G possibly damaging Het
Rnf220 T C 4: 117,296,142 D299G probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Scn2a G A 2: 65,764,819 S2004N probably benign Het
Slc7a4 T A 16: 17,573,407 N593I probably damaging Het
Speg T C 1: 75,422,508 S2200P probably benign Het
Tle1 A T 4: 72,122,359 H654Q probably benign Het
Ttll6 G A 11: 96,135,762 R124H probably damaging Het
Vmn2r89 T C 14: 51,455,831 S213P probably damaging Het
Washc4 A G 10: 83,560,523 N399S probably benign Het
Wdr37 G A 13: 8,847,627 H198Y Het
Zfp407 A G 18: 84,562,454 L178P probably benign Het
Zfp882 C T 8: 71,914,987 H553Y probably damaging Het
Zfp956 T C 6: 47,963,436 V243A probably benign Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22571245 missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22548184 missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7146:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22548714 missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22571086 missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22548399 missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22570733 missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22573102 missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22571488 missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22573092 missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22548581 missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22571293 missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22559042 critical splice donor site probably null
R8540:Vmn2r111 UTSW 17 22559043 missense probably damaging 1.00
R8557:Vmn2r111 UTSW 17 22571929 nonsense probably null
R8720:Vmn2r111 UTSW 17 22573213 missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22548258 missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22548030 missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22571841 missense probably benign
R9374:Vmn2r111 UTSW 17 22568878 missense probably benign 0.17
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTCCAATATGGGAGCAAGACG -3'
(R):5'- ACAGGATGCTATCAGGTTTTCTTC -3'

Sequencing Primer
(F):5'- GGAGCAAGACGATATTCCTTTTG -3'
(R):5'- TTCAAGGAGTTGGGAAACAATTC -3'
Posted On 2022-06-15