Incidental Mutation 'R9452:Capn1'
ID 714367
Institutional Source Beutler Lab
Gene Symbol Capn1
Ensembl Gene ENSMUSG00000024942
Gene Name calpain 1
Synonyms mu-calpin, Capa1, Capa-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9452 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 5988546-6015825 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6007257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 387 (Y387C)
Ref Sequence ENSEMBL: ENSMUSP00000025891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025891] [ENSMUST00000164843]
AlphaFold O35350
Predicted Effect probably damaging
Transcript: ENSMUST00000025891
AA Change: Y387C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025891
Gene: ENSMUSG00000024942
AA Change: Y387C

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164843
AA Change: Y387C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127498
Gene: ENSMUSG00000024942
AA Change: Y387C

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 1. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a mutation of this gene exhibit decreased platelet aggregation and defective clot retraction although bleeding times remain similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb8 A G 5: 24,407,384 Y564C probably null Het
Ablim2 A T 5: 35,857,854 D470V probably benign Het
Actr10 T C 12: 70,960,044 probably null Het
Adam4 T A 12: 81,420,297 I517L probably benign Het
Ank1 C A 8: 23,132,413 D1659E probably benign Het
Arnt2 A G 7: 84,284,126 V308A probably benign Het
Avl9 T C 6: 56,729,741 V184A probably damaging Het
Bag1 A T 4: 40,947,733 I157N probably benign Het
BC005561 T A 5: 104,521,744 N1377K probably benign Het
Bicc1 A T 10: 70,957,151 D224E probably damaging Het
C2 T G 17: 34,876,343 I209L probably benign Het
Cacna1e A T 1: 154,413,974 probably null Het
Cebpa A G 7: 35,119,608 I64V possibly damaging Het
Celf4 T G 18: 25,491,162 M436L probably benign Het
Cfb C A 17: 34,859,108 V436L probably benign Het
Ciart C T 3: 95,881,215 C104Y probably benign Het
Cmya5 A G 13: 93,095,886 L898P probably benign Het
Cyp2c68 A T 19: 39,699,389 M388K possibly damaging Het
Cypt12 T C 3: 17,948,679 V72A probably benign Het
Dlec1 A G 9: 119,112,473 D309G probably benign Het
Dnah1 A G 14: 31,296,491 V1394A probably benign Het
Dpp3 A C 19: 4,923,722 S108A probably benign Het
Eif5b C T 1: 38,045,780 P903S probably damaging Het
Erc2 A G 14: 28,011,733 D580G probably damaging Het
Fam98c A G 7: 29,153,476 V44A probably benign Het
Fer A G 17: 63,924,072 K273E probably benign Het
Gm906 T C 13: 50,246,772 H506R possibly damaging Het
Gm9268 A T 7: 43,047,833 L771F possibly damaging Het
Gzme T A 14: 56,118,397 I153F probably benign Het
Ice1 A T 13: 70,596,343 N2040K probably damaging Het
Ifi214 G T 1: 173,529,328 Q70K possibly damaging Het
Itpripl1 C A 2: 127,141,414 E263* probably null Het
Kat8 A G 7: 127,925,249 K433R probably benign Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lefty1 A T 1: 180,935,284 T59S probably benign Het
Lig3 C T 11: 82,790,622 T481M probably damaging Het
Lrfn1 A T 7: 28,459,732 I359F probably damaging Het
Lrp1b A T 2: 41,960,714 C90* probably null Het
Micall2 T G 5: 139,717,556 probably null Het
Mtmr3 G T 11: 4,491,037 L539I probably damaging Het
Obscn C A 11: 59,034,136 probably null Het
Olfml3 T C 3: 103,736,259 T269A probably benign Het
Olfr1217 C T 2: 89,023,890 G38R Het
Oprl1 C T 2: 181,718,661 A170V possibly damaging Het
Pdgfrb G A 18: 61,065,726 V319M possibly damaging Het
Pirb G A 7: 3,717,618 R294C possibly damaging Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Pkd2 T C 5: 104,466,975 F228L probably damaging Het
Pkhd1 T A 1: 20,612,729 D83V possibly damaging Het
Plcl1 A G 1: 55,695,833 D111G probably damaging Het
Plpp2 A G 10: 79,527,868 S162P probably damaging Het
Prex2 T A 1: 11,185,927 I1174K probably benign Het
Prkdc T A 16: 15,667,601 Y431N possibly damaging Het
Pter A G 2: 12,980,300 D147G probably benign Het
Rbsn T C 6: 92,201,764 D134G possibly damaging Het
Rnf220 T C 4: 117,296,142 D299G probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Scn2a G A 2: 65,764,819 S2004N probably benign Het
Slc7a4 T A 16: 17,573,407 N593I probably damaging Het
Speg T C 1: 75,422,508 S2200P probably benign Het
Tle1 A T 4: 72,122,359 H654Q probably benign Het
Ttll6 G A 11: 96,135,762 R124H probably damaging Het
Vmn2r111 A G 17: 22,559,151 C516R probably damaging Het
Vmn2r89 T C 14: 51,455,831 S213P probably damaging Het
Washc4 A G 10: 83,560,523 N399S probably benign Het
Wdr37 G A 13: 8,847,627 H198Y Het
Zfp407 A G 18: 84,562,454 L178P probably benign Het
Zfp882 C T 8: 71,914,987 H553Y probably damaging Het
Zfp956 T C 6: 47,963,436 V243A probably benign Het
Other mutations in Capn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Capn1 APN 19 6007269 missense probably damaging 1.00
IGL01314:Capn1 APN 19 5989984 splice site probably benign
R0044:Capn1 UTSW 19 6014343 missense probably benign 0.03
R1496:Capn1 UTSW 19 6007498 critical splice donor site probably null
R1646:Capn1 UTSW 19 5997730 missense probably benign
R1852:Capn1 UTSW 19 6009103 missense possibly damaging 0.95
R1924:Capn1 UTSW 19 5990056 splice site probably null
R2006:Capn1 UTSW 19 5991583 missense probably damaging 1.00
R2109:Capn1 UTSW 19 6014358 missense probably benign 0.01
R3704:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3705:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3830:Capn1 UTSW 19 5994847 missense probably damaging 1.00
R4664:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4665:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4666:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4694:Capn1 UTSW 19 5994731 nonsense probably null
R4745:Capn1 UTSW 19 5993916 missense probably benign 0.12
R5103:Capn1 UTSW 19 6009110 missense probably damaging 1.00
R5149:Capn1 UTSW 19 5990334 splice site probably null
R5569:Capn1 UTSW 19 6013660 missense probably benign
R5636:Capn1 UTSW 19 6014442 missense probably benign 0.22
R5906:Capn1 UTSW 19 6011421 missense possibly damaging 0.90
R5907:Capn1 UTSW 19 5997797 missense probably benign
R7038:Capn1 UTSW 19 6014319 missense probably benign 0.23
R7091:Capn1 UTSW 19 5991556 missense possibly damaging 0.64
R7307:Capn1 UTSW 19 5993908 missense possibly damaging 0.91
R7592:Capn1 UTSW 19 6014439 missense probably benign 0.00
R7779:Capn1 UTSW 19 5994086 missense probably benign
R8514:Capn1 UTSW 19 5997824 missense probably damaging 0.98
R8708:Capn1 UTSW 19 6011298 missense probably damaging 1.00
Z1176:Capn1 UTSW 19 6014278 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACAAGGCTTTCTTCCCCGG -3'
(R):5'- GGGGAGTTCTGGTAAGCAACAC -3'

Sequencing Primer
(F):5'- GGCCCCAGACAGTCTAGCAAG -3'
(R):5'- CCCAGTTCATGATGGAGGACTG -3'
Posted On 2022-06-15