Incidental Mutation 'R9453:Atad2b'
ID 714414
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms 1110014E10Rik, D530031C13Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9453 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 4967353-5097394 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5081578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1162 (D1162E)
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664]
AlphaFold E9Q166
Predicted Effect probably benign
Transcript: ENSMUST00000045664
AA Change: D1162E

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: D1162E

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,771,054 (GRCm39) A179T probably benign Het
Abca6 A G 11: 110,138,090 (GRCm39) probably null Het
Agps A C 2: 75,662,585 (GRCm39) D10A probably damaging Het
Atp13a4 T C 16: 29,239,659 (GRCm39) K851R unknown Het
Cdh15 A G 8: 123,586,029 (GRCm39) D136G probably damaging Het
Cdk5rap1 A T 2: 154,190,585 (GRCm39) Y459N probably damaging Het
Cep192 A T 18: 67,989,354 (GRCm39) K1834* probably null Het
Cfap221 C T 1: 119,853,361 (GRCm39) V778I probably benign Het
Chpf G A 1: 75,452,854 (GRCm39) T362I probably benign Het
Cyp4x1 T C 4: 114,991,069 (GRCm39) R36G probably damaging Het
D16Ertd472e T A 16: 78,342,052 (GRCm39) Q276L probably damaging Het
Dapk3 T C 10: 81,025,825 (GRCm39) Y39H probably damaging Het
Eefsec T C 6: 88,353,337 (GRCm39) T111A probably damaging Het
Ehbp1l1 G A 19: 5,758,371 (GRCm39) R1714C unknown Het
Flcn A G 11: 59,694,609 (GRCm39) V121A probably damaging Het
Gaa G T 11: 119,165,958 (GRCm39) D423Y probably damaging Het
Gaa A C 11: 119,165,959 (GRCm39) D423A probably benign Het
Garnl3 A G 2: 32,893,881 (GRCm39) I694T probably damaging Het
Gm5114 T A 7: 39,058,242 (GRCm39) Q459L probably damaging Het
H1f0 C T 15: 78,912,947 (GRCm39) P9L probably damaging Het
Hmmr A G 11: 40,612,655 (GRCm39) probably null Het
Klra5 C A 6: 129,883,686 (GRCm39) W147L possibly damaging Het
Lmnb1 G A 18: 56,873,114 (GRCm39) probably null Het
Lrp2 T C 2: 69,288,832 (GRCm39) Y3678C probably damaging Het
Map7 T C 10: 20,153,981 (GRCm39) V699A unknown Het
Mme G T 3: 63,272,306 (GRCm39) G635V possibly damaging Het
Mroh8 A T 2: 157,071,948 (GRCm39) I519N possibly damaging Het
Mrps11 T C 7: 78,442,390 (GRCm39) S157P probably damaging Het
Muc16 T C 9: 18,572,061 (GRCm39) T153A unknown Het
Nlrp1b A G 11: 71,072,913 (GRCm39) V310A probably damaging Het
Oas1f T C 5: 120,993,592 (GRCm39) V268A probably damaging Het
Or56a3b T A 7: 104,770,817 (GRCm39) I51N Het
Or6y1 A T 1: 174,276,233 (GRCm39) T15S probably benign Het
Padi4 A G 4: 140,479,950 (GRCm39) L401P probably benign Het
Pdzd7 A G 19: 45,016,056 (GRCm39) *1022Q probably null Het
Plcl2 C A 17: 50,915,391 (GRCm39) T800K probably damaging Het
Polr1has TCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCAC 17: 37,275,939 (GRCm39) probably benign Het
Ppp1r37 A T 7: 19,295,796 (GRCm39) F54I probably damaging Het
Prl7c1 T A 13: 27,957,870 (GRCm39) Y190F probably benign Het
Prpf8 A G 11: 75,397,212 (GRCm39) E2015G possibly damaging Het
Rpap3 A G 15: 97,579,641 (GRCm39) V457A Het
Samd13 A T 3: 146,368,510 (GRCm39) D27E Het
Sephs1 A T 2: 4,889,174 (GRCm39) probably benign Het
Slc22a20 T G 19: 6,023,024 (GRCm39) Q373P probably damaging Het
Sp100 A G 1: 85,629,179 (GRCm39) *483W probably null Het
Src A T 2: 157,307,852 (GRCm39) T254S probably damaging Het
St6galnac2 A T 11: 116,569,344 (GRCm39) M301K possibly damaging Het
Tnfsf13 A T 11: 69,576,010 (GRCm39) W26R probably damaging Het
Trbv28 T A 6: 41,248,687 (GRCm39) D72E probably benign Het
Trim75 T A 8: 65,436,561 (GRCm39) probably benign Het
Ttc39d T C 17: 80,524,754 (GRCm39) F471S probably damaging Het
Vav1 C T 17: 57,613,191 (GRCm39) P621L probably benign Het
Vezt A T 10: 93,832,856 (GRCm39) L185* probably null Het
Vmn2r42 T C 7: 8,187,295 (GRCm39) I826V probably benign Het
Vmn2r67 G A 7: 84,800,697 (GRCm39) T413M probably benign Het
Vnn1 G A 10: 23,776,723 (GRCm39) C358Y probably damaging Het
Wdr83os G C 8: 85,808,638 (GRCm39) W106C probably damaging Het
Wdr95 T C 5: 149,475,917 (GRCm39) S72P probably damaging Het
Zfp423 T A 8: 88,508,251 (GRCm39) T698S probably damaging Het
Zfp521 G A 18: 13,977,293 (GRCm39) T1040I probably damaging Het
Zfp563 T A 17: 33,308,565 (GRCm39) V9E Het
Zmym2 T A 14: 57,180,770 (GRCm39) V894E probably damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5,074,593 (GRCm39) missense probably damaging 1.00
IGL00917:Atad2b APN 12 5,015,837 (GRCm39) unclassified probably benign
IGL01011:Atad2b APN 12 5,015,984 (GRCm39) missense probably benign 0.01
IGL01092:Atad2b APN 12 5,067,987 (GRCm39) missense probably damaging 0.98
IGL01604:Atad2b APN 12 5,015,837 (GRCm39) unclassified probably benign
IGL01924:Atad2b APN 12 5,084,093 (GRCm39) missense probably damaging 1.00
IGL02197:Atad2b APN 12 5,068,056 (GRCm39) missense possibly damaging 0.84
IGL02397:Atad2b APN 12 5,024,046 (GRCm39) missense probably damaging 1.00
IGL02404:Atad2b APN 12 4,991,972 (GRCm39) missense probably benign 0.08
IGL02517:Atad2b APN 12 5,068,037 (GRCm39) missense probably benign 0.07
IGL02726:Atad2b APN 12 5,024,003 (GRCm39) nonsense probably null
IGL02896:Atad2b APN 12 5,008,151 (GRCm39) missense probably damaging 1.00
IGL03227:Atad2b APN 12 5,056,715 (GRCm39) missense probably damaging 1.00
IGL03265:Atad2b APN 12 5,074,628 (GRCm39) missense probably benign 0.24
Plyers UTSW 12 5,023,970 (GRCm39) missense probably damaging 1.00
Smidge UTSW 12 5,040,949 (GRCm39) missense probably damaging 1.00
Tensor UTSW 12 5,007,558 (GRCm39) missense probably damaging 1.00
Traction UTSW 12 5,077,182 (GRCm39) critical splice donor site probably null
Vice UTSW 12 5,068,002 (GRCm39) missense probably damaging 1.00
K3955:Atad2b UTSW 12 5,004,536 (GRCm39) splice site probably benign
P0038:Atad2b UTSW 12 5,004,536 (GRCm39) splice site probably benign
PIT4418001:Atad2b UTSW 12 5,074,587 (GRCm39) missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5,081,795 (GRCm39) missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4,992,030 (GRCm39) missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4,992,030 (GRCm39) missense possibly damaging 0.81
R0124:Atad2b UTSW 12 5,002,676 (GRCm39) missense probably benign 0.23
R0462:Atad2b UTSW 12 4,991,973 (GRCm39) missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4,995,035 (GRCm39) splice site probably benign
R0617:Atad2b UTSW 12 4,987,401 (GRCm39) missense probably benign 0.43
R0894:Atad2b UTSW 12 5,015,915 (GRCm39) missense probably damaging 1.00
R0942:Atad2b UTSW 12 5,074,591 (GRCm39) missense probably damaging 1.00
R0960:Atad2b UTSW 12 5,056,593 (GRCm39) splice site probably benign
R0973:Atad2b UTSW 12 5,081,784 (GRCm39) missense probably benign 0.00
R1306:Atad2b UTSW 12 5,024,239 (GRCm39) missense probably benign 0.08
R1530:Atad2b UTSW 12 4,992,018 (GRCm39) nonsense probably null
R1678:Atad2b UTSW 12 5,015,899 (GRCm39) missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5,084,575 (GRCm39) nonsense probably null
R1826:Atad2b UTSW 12 5,024,094 (GRCm39) missense probably benign 0.00
R1996:Atad2b UTSW 12 5,040,883 (GRCm39) missense probably benign 0.01
R2233:Atad2b UTSW 12 5,056,745 (GRCm39) missense probably damaging 1.00
R2235:Atad2b UTSW 12 5,056,745 (GRCm39) missense probably damaging 1.00
R2943:Atad2b UTSW 12 4,992,067 (GRCm39) missense probably damaging 0.98
R3161:Atad2b UTSW 12 4,989,689 (GRCm39) missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4,989,689 (GRCm39) missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4,989,689 (GRCm39) missense possibly damaging 0.87
R3508:Atad2b UTSW 12 5,000,595 (GRCm39) critical splice donor site probably null
R4239:Atad2b UTSW 12 5,035,710 (GRCm39) missense probably benign 0.05
R4401:Atad2b UTSW 12 4,990,145 (GRCm39) missense probably damaging 0.99
R4558:Atad2b UTSW 12 4,993,223 (GRCm39) missense probably benign 0.10
R4559:Atad2b UTSW 12 4,993,223 (GRCm39) missense probably benign 0.10
R4573:Atad2b UTSW 12 5,004,663 (GRCm39) splice site probably null
R4639:Atad2b UTSW 12 5,068,053 (GRCm39) missense probably damaging 1.00
R4847:Atad2b UTSW 12 4,994,901 (GRCm39) splice site probably null
R4850:Atad2b UTSW 12 4,993,251 (GRCm39) missense probably benign 0.15
R4851:Atad2b UTSW 12 4,993,251 (GRCm39) missense probably benign 0.15
R4979:Atad2b UTSW 12 5,084,513 (GRCm39) missense probably damaging 1.00
R5024:Atad2b UTSW 12 4,987,534 (GRCm39) missense probably benign 0.45
R5305:Atad2b UTSW 12 5,015,855 (GRCm39) missense probably damaging 1.00
R5405:Atad2b UTSW 12 4,990,098 (GRCm39) missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4,967,911 (GRCm39) missense probably benign 0.01
R5754:Atad2b UTSW 12 5,060,351 (GRCm39) missense probably benign 0.01
R6163:Atad2b UTSW 12 5,004,593 (GRCm39) missense probably benign 0.00
R6371:Atad2b UTSW 12 5,023,970 (GRCm39) missense probably damaging 1.00
R6374:Atad2b UTSW 12 5,068,002 (GRCm39) missense probably damaging 1.00
R6399:Atad2b UTSW 12 5,007,558 (GRCm39) missense probably damaging 1.00
R6433:Atad2b UTSW 12 5,002,642 (GRCm39) missense possibly damaging 0.89
R6546:Atad2b UTSW 12 5,040,949 (GRCm39) missense probably damaging 1.00
R6617:Atad2b UTSW 12 5,074,668 (GRCm39) missense probably benign 0.00
R7199:Atad2b UTSW 12 5,067,992 (GRCm39) missense probably damaging 1.00
R7267:Atad2b UTSW 12 5,077,105 (GRCm39) nonsense probably null
R7405:Atad2b UTSW 12 4,993,232 (GRCm39) missense probably benign 0.08
R7460:Atad2b UTSW 12 5,002,660 (GRCm39) missense probably benign 0.28
R7568:Atad2b UTSW 12 5,060,390 (GRCm39) critical splice donor site probably null
R7593:Atad2b UTSW 12 5,081,726 (GRCm39) missense probably benign 0.16
R7648:Atad2b UTSW 12 5,077,182 (GRCm39) critical splice donor site probably null
R8253:Atad2b UTSW 12 5,024,160 (GRCm39) missense probably benign 0.02
R8253:Atad2b UTSW 12 5,024,159 (GRCm39) missense possibly damaging 0.54
R8708:Atad2b UTSW 12 5,011,253 (GRCm39) missense probably damaging 1.00
R8894:Atad2b UTSW 12 5,064,001 (GRCm39) critical splice donor site probably null
R8948:Atad2b UTSW 12 5,041,012 (GRCm39) missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4,967,923 (GRCm39) critical splice donor site probably null
R9052:Atad2b UTSW 12 5,015,982 (GRCm39) missense probably damaging 1.00
R9057:Atad2b UTSW 12 5,068,102 (GRCm39) nonsense probably null
R9134:Atad2b UTSW 12 5,060,351 (GRCm39) missense probably benign 0.01
R9450:Atad2b UTSW 12 5,063,859 (GRCm39) missense probably benign 0.06
R9494:Atad2b UTSW 12 5,081,852 (GRCm39) missense probably benign 0.26
R9634:Atad2b UTSW 12 5,060,332 (GRCm39) missense probably damaging 1.00
R9764:Atad2b UTSW 12 5,082,064 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCAGCATGGATATCATCAGCC -3'
(R):5'- GACCCTGGTCCATATCCATGATG -3'

Sequencing Primer
(F):5'- GGATATCATCAGCCAAGAATTTTTG -3'
(R):5'- GGTCCATATCCATGATGTCACATG -3'
Posted On 2022-06-15