Incidental Mutation 'R9453:Atp13a4'
ID 714419
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 9330174J19Rik, 4631413J11Rik
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9453 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 29395853-29544864 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29420841 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 851 (K851R)
Ref Sequence ENSEMBL: ENSMUSP00000048753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000039090
AA Change: K851R
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094
AA Change: K851R

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057018
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182168
Predicted Effect probably benign
Transcript: ENSMUST00000182573
Predicted Effect probably benign
Transcript: ENSMUST00000182627
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,880,228 A179T probably benign Het
Abca6 A G 11: 110,247,264 probably null Het
Agps A C 2: 75,832,241 D10A probably damaging Het
Atad2b T A 12: 5,031,578 D1162E probably benign Het
Cdh15 A G 8: 122,859,290 D136G probably damaging Het
Cdk5rap1 A T 2: 154,348,665 Y459N probably damaging Het
Cep192 A T 18: 67,856,283 K1834* probably null Het
Cfap221 C T 1: 119,925,631 V778I probably benign Het
Chpf G A 1: 75,476,210 T362I probably benign Het
Cyp4x1 T C 4: 115,133,872 R36G probably damaging Het
D16Ertd472e T A 16: 78,545,164 Q276L probably damaging Het
Dapk3 T C 10: 81,189,991 Y39H probably damaging Het
Eefsec T C 6: 88,376,355 T111A probably damaging Het
Ehbp1l1 G A 19: 5,708,343 R1714C unknown Het
Flcn A G 11: 59,803,783 V121A probably damaging Het
Gaa G T 11: 119,275,132 D423Y probably damaging Het
Gaa A C 11: 119,275,133 D423A probably benign Het
Garnl3 A G 2: 33,003,869 I694T probably damaging Het
Gm5114 T A 7: 39,408,818 Q459L probably damaging Het
H1f0 C T 15: 79,028,747 P9L probably damaging Het
Hmmr A G 11: 40,721,828 probably null Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Lmnb1 G A 18: 56,740,042 probably null Het
Lrp2 T C 2: 69,458,488 Y3678C probably damaging Het
Map7 T C 10: 20,278,235 V699A unknown Het
Mme G T 3: 63,364,885 G635V possibly damaging Het
Mroh8 A T 2: 157,230,028 I519N possibly damaging Het
Mrps11 T C 7: 78,792,642 S157P probably damaging Het
Muc16 T C 9: 18,660,765 T153A unknown Het
Nlrp1b A G 11: 71,182,087 V310A probably damaging Het
Oas1f T C 5: 120,855,529 V268A probably damaging Het
Olfr220 A T 1: 174,448,667 T15S probably benign Het
Olfr681 T A 7: 105,121,610 I51N Het
Padi4 A G 4: 140,752,639 L401P probably benign Het
Pdzd7 A G 19: 45,027,617 *1022Q probably null Het
Plcl2 C A 17: 50,608,363 T800K probably damaging Het
Ppp1r37 A T 7: 19,561,871 F54I probably damaging Het
Prl7c1 T A 13: 27,773,887 Y190F probably benign Het
Prpf8 A G 11: 75,506,386 E2015G possibly damaging Het
Rpap3 A G 15: 97,681,760 V457A Het
Samd13 A T 3: 146,662,755 D27E Het
Sephs1 A T 2: 4,884,363 probably benign Het
Slc22a20 T G 19: 5,972,996 Q373P probably damaging Het
Sp100 A G 1: 85,701,458 *483W probably null Het
Src A T 2: 157,465,932 T254S probably damaging Het
St6galnac2 A T 11: 116,678,518 M301K possibly damaging Het
Tnfsf13 A T 11: 69,685,184 W26R probably damaging Het
Trbv29 T A 6: 41,271,753 D72E probably benign Het
Trim75 T A 8: 64,983,909 probably benign Het
Ttc39d T C 17: 80,217,325 F471S probably damaging Het
Vav1 C T 17: 57,306,191 P621L probably benign Het
Vezt A T 10: 93,996,994 L185* probably null Het
Vmn2r42 T C 7: 8,184,296 I826V probably benign Het
Vmn2r67 G A 7: 85,151,489 T413M probably benign Het
Vnn1 G A 10: 23,900,825 C358Y probably damaging Het
Wdr83os G C 8: 85,082,009 W106C probably damaging Het
Wdr95 T C 5: 149,552,452 S72P probably damaging Het
Zfp423 T A 8: 87,781,623 T698S probably damaging Het
Zfp521 G A 18: 13,844,236 T1040I probably damaging Het
Zfp563 T A 17: 33,089,591 V9E Het
Zmym2 T A 14: 56,943,313 V894E probably damaging Het
Znrd1as TCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCAC 17: 36,965,047 probably benign Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7739:Atp13a4 UTSW 16 29456601 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R7950:Atp13a4 UTSW 16 29449917 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
R8488:Atp13a4 UTSW 16 29417836 missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29454769 nonsense probably null
R8773:Atp13a4 UTSW 16 29441580 missense
R8921:Atp13a4 UTSW 16 29454774 missense
R8940:Atp13a4 UTSW 16 29454690 critical splice donor site probably null
R9056:Atp13a4 UTSW 16 29471888 critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29449979 missense
R9292:Atp13a4 UTSW 16 29422682 missense
R9415:Atp13a4 UTSW 16 29409003 missense
R9497:Atp13a4 UTSW 16 29469312 critical splice acceptor site probably null
R9541:Atp13a4 UTSW 16 29422726 missense
R9614:Atp13a4 UTSW 16 29441580 missense
R9622:Atp13a4 UTSW 16 29420459 missense
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- TGGAGAAAGTTTGTTCCCAGTG -3'
(R):5'- CTGAGCTTCATAATTGGTCAAGCTC -3'

Sequencing Primer
(F):5'- GTTTGTTCCCAGTGAAATGATTCC -3'
(R):5'- CCTGGTGATTTTCAGCTAG -3'
Posted On 2022-06-15