Incidental Mutation 'R9454:Raph1'
ID 714432
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene Name Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms C730009O10Rik, lamellipodin, 9430025M21Rik, Lpd
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R9454 (G1)
Quality Score 159.009
Status Not validated
Chromosome 1
Chromosomal Location 60521451-60606263 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 60528753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 836 (Q836L)
Ref Sequence ENSEMBL: ENSMUSP00000121023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]
AlphaFold F2Z3U3
Predicted Effect probably benign
Transcript: ENSMUST00000027168
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090293
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140485
AA Change: Q836L
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: Q836L

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182085
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 G T 18: 61,952,067 (GRCm39) H431Q possibly damaging Het
Adam25 A T 8: 41,207,486 (GRCm39) I251F probably damaging Het
Ankrd31 A T 13: 96,916,842 (GRCm39) T119S probably damaging Het
Ankrd31 T C 13: 96,916,846 (GRCm39) V120A possibly damaging Het
Anks6 T C 4: 47,016,789 (GRCm39) E809G possibly damaging Het
Arhgap21 A T 2: 20,870,153 (GRCm39) S928T probably damaging Het
Arhgef10l G T 4: 140,308,236 (GRCm39) S39* probably null Het
Aspm G A 1: 139,408,732 (GRCm39) E2540K probably benign Het
Atp10a T C 7: 58,308,339 (GRCm39) I46T probably benign Het
Atp13a5 C A 16: 29,133,338 (GRCm39) V483L possibly damaging Het
BC028528 T C 3: 95,797,082 (GRCm39) D29G possibly damaging Het
Ccdc187 T A 2: 26,166,114 (GRCm39) T772S possibly damaging Het
Ccnh G A 13: 85,350,521 (GRCm39) A199T probably benign Het
Cfap65 A T 1: 74,944,210 (GRCm39) Y1504N probably damaging Het
Ckap2 C A 8: 22,665,899 (GRCm39) E383* probably null Het
Clec4n T C 6: 123,212,532 (GRCm39) V116A possibly damaging Het
Cmc2 G T 8: 117,616,550 (GRCm39) D58E unknown Het
Cntn6 A G 6: 104,781,308 (GRCm39) K465E possibly damaging Het
Col6a6 G A 9: 105,661,059 (GRCm39) A350V probably damaging Het
Cps1 A G 1: 67,219,311 (GRCm39) I884V probably damaging Het
E2f7 C T 10: 110,620,542 (GRCm39) A853V probably benign Het
E330034G19Rik A T 14: 24,346,860 (GRCm39) Q114L unknown Het
Egfr G T 11: 16,837,155 (GRCm39) G632V probably damaging Het
Fam98b T C 2: 117,080,250 (GRCm39) M1T probably null Het
Fcgr2b T A 1: 170,788,657 (GRCm39) I317F probably damaging Het
Galntl6 T C 8: 58,411,435 (GRCm39) D265G probably damaging Het
Gm4922 A G 10: 18,660,329 (GRCm39) L131P probably damaging Het
H1f7 T C 15: 98,154,823 (GRCm39) I109V probably benign Het
H2-Q1 A T 17: 35,540,349 (GRCm39) I145F probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,934,702 (GRCm39) probably benign Het
Ica1 A T 6: 8,667,288 (GRCm39) S293T probably benign Het
Ift70a2 T A 2: 75,806,812 (GRCm39) I567F probably benign Het
Klra5 C A 6: 129,883,686 (GRCm39) W147L possibly damaging Het
Magi2 G T 5: 20,671,176 (GRCm39) V507F probably damaging Het
Malrd1 G A 2: 15,802,537 (GRCm39) W1083* probably null Het
Malrd1 T C 2: 15,757,660 (GRCm39) I978T unknown Het
Mgarp T C 3: 51,303,902 (GRCm39) T10A probably damaging Het
Mtnr1a A G 8: 45,538,612 (GRCm39) I17V Het
Muc5ac C T 7: 141,362,431 (GRCm39) T1914I unknown Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Nav3 T C 10: 109,835,864 (GRCm39) T73A probably benign Het
Or4b1 A C 2: 89,979,820 (GRCm39) C177G probably damaging Het
Or8k21 A T 2: 86,145,178 (GRCm39) Y151N probably damaging Het
Pclo T A 5: 14,762,452 (GRCm39) S357T probably benign Het
Pkdrej T A 15: 85,702,420 (GRCm39) N1172I probably benign Het
Psmb9 G A 17: 34,402,078 (GRCm39) R173C probably benign Het
Ralgapb T A 2: 158,315,072 (GRCm39) H1146Q probably benign Het
Rcc1 A G 4: 132,062,074 (GRCm39) S280P probably damaging Het
Recql T C 6: 142,320,617 (GRCm39) M144V possibly damaging Het
Rela T C 19: 5,695,368 (GRCm39) I298T probably damaging Het
Rfc1 T A 5: 65,431,774 (GRCm39) I792F Het
Rnf31 A G 14: 55,833,609 (GRCm39) E539G Het
Rrp9 T C 9: 106,360,840 (GRCm39) S274P possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,130 (GRCm39) probably benign Het
Scmh1 A G 4: 120,372,276 (GRCm39) I360V probably benign Het
Sh3yl1 T C 12: 30,990,420 (GRCm39) probably null Het
Shisa9 T C 16: 11,802,523 (GRCm39) S27P probably benign Het
Slc17a4 A G 13: 24,085,910 (GRCm39) V359A probably benign Het
Slfn5 C A 11: 82,850,885 (GRCm39) A394E probably benign Het
Sun3 A G 11: 8,988,281 (GRCm39) F14L probably benign Het
Surf1 A T 2: 26,804,808 (GRCm39) D148E possibly damaging Het
Syne2 A T 12: 76,141,844 (GRCm39) K1388* probably null Het
Syne2 A G 12: 76,067,275 (GRCm39) K4325E probably damaging Het
Tacr1 A G 6: 82,531,853 (GRCm39) M250V probably damaging Het
Tenm2 T C 11: 36,112,286 (GRCm39) T420A probably benign Het
Tm7sf3 C A 6: 146,520,041 (GRCm39) A282S probably benign Het
Tmf1 T C 6: 97,155,866 (GRCm39) E40G probably benign Het
Tnfrsf12a A G 17: 23,895,491 (GRCm39) probably null Het
Unc80 C A 1: 66,734,749 (GRCm39) H3325Q possibly damaging Het
Vamp9 C T 5: 100,070,952 (GRCm39) P76S probably damaging Het
Zfp142 A G 1: 74,609,016 (GRCm39) L1593S probably damaging Het
Zfp869 T A 8: 70,159,241 (GRCm39) Y444F probably benign Het
Zscan10 G A 17: 23,826,619 (GRCm39) probably null Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60,565,106 (GRCm39) missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60,542,022 (GRCm39) missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0227:Raph1 UTSW 1 60,565,136 (GRCm39) missense probably benign 0.00
R0387:Raph1 UTSW 1 60,549,655 (GRCm39) intron probably benign
R0607:Raph1 UTSW 1 60,565,028 (GRCm39) missense probably damaging 1.00
R1740:Raph1 UTSW 1 60,558,183 (GRCm39) nonsense probably null
R2274:Raph1 UTSW 1 60,537,659 (GRCm39) missense probably damaging 1.00
R3108:Raph1 UTSW 1 60,532,545 (GRCm39) missense probably benign 0.01
R3977:Raph1 UTSW 1 60,537,682 (GRCm39) missense probably benign 0.39
R4260:Raph1 UTSW 1 60,542,124 (GRCm39) missense possibly damaging 0.94
R4487:Raph1 UTSW 1 60,542,028 (GRCm39) missense possibly damaging 0.68
R4721:Raph1 UTSW 1 60,542,160 (GRCm39) unclassified probably benign
R4782:Raph1 UTSW 1 60,528,273 (GRCm39) missense probably damaging 1.00
R5027:Raph1 UTSW 1 60,535,436 (GRCm39) missense probably damaging 1.00
R5037:Raph1 UTSW 1 60,535,381 (GRCm39) splice site probably null
R5106:Raph1 UTSW 1 60,572,459 (GRCm39) missense probably damaging 1.00
R5506:Raph1 UTSW 1 60,532,657 (GRCm39) intron probably benign
R5510:Raph1 UTSW 1 60,562,105 (GRCm39) unclassified probably benign
R5587:Raph1 UTSW 1 60,537,632 (GRCm39) missense probably damaging 1.00
R5591:Raph1 UTSW 1 60,540,905 (GRCm39) unclassified probably benign
R5619:Raph1 UTSW 1 60,529,414 (GRCm39) intron probably benign
R5776:Raph1 UTSW 1 60,529,315 (GRCm39) intron probably benign
R5802:Raph1 UTSW 1 60,527,832 (GRCm39) missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60,564,879 (GRCm39) missense probably damaging 0.97
R7122:Raph1 UTSW 1 60,565,136 (GRCm39) missense probably benign 0.10
R7219:Raph1 UTSW 1 60,542,032 (GRCm39) missense unknown
R7251:Raph1 UTSW 1 60,529,027 (GRCm39) missense unknown
R7254:Raph1 UTSW 1 60,538,767 (GRCm39) missense unknown
R7732:Raph1 UTSW 1 60,572,447 (GRCm39) missense possibly damaging 0.82
R7979:Raph1 UTSW 1 60,565,148 (GRCm39) missense probably benign 0.00
R7986:Raph1 UTSW 1 60,535,445 (GRCm39) missense
R8167:Raph1 UTSW 1 60,529,270 (GRCm39) missense unknown
R8168:Raph1 UTSW 1 60,538,779 (GRCm39) missense unknown
R8399:Raph1 UTSW 1 60,528,477 (GRCm39) missense unknown
R9036:Raph1 UTSW 1 60,542,124 (GRCm39) missense unknown
R9146:Raph1 UTSW 1 60,558,137 (GRCm39) critical splice donor site probably null
R9338:Raph1 UTSW 1 60,529,300 (GRCm39) missense unknown
R9381:Raph1 UTSW 1 60,540,959 (GRCm39) missense unknown
R9383:Raph1 UTSW 1 60,564,829 (GRCm39) missense unknown
R9399:Raph1 UTSW 1 60,565,154 (GRCm39) missense probably benign
R9561:Raph1 UTSW 1 60,564,887 (GRCm39) missense possibly damaging 0.49
RF018:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
RF022:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- CTTGCTGGCAGGGACTTTAG -3'
(R):5'- GTTCAGCACCTTCCTCAGAC -3'

Sequencing Primer
(F):5'- ACTTTAGGGGCTGAGAGTCCAC -3'
(R):5'- GCAACTGTCCCTCCTCAAG -3'
Posted On 2022-06-15