Incidental Mutation 'R9454:Raph1'
ID 714432
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene Name Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R9454 (G1)
Quality Score 159.009
Status Not validated
Chromosome 1
Chromosomal Location 60482292-60567104 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 60489594 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 836 (Q836L)
Ref Sequence ENSEMBL: ENSMUSP00000121023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]
AlphaFold F2Z3U3
Predicted Effect probably benign
Transcript: ENSMUST00000027168
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090293
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140485
AA Change: Q836L
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: Q836L

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182085
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 G T 18: 61,818,996 H431Q possibly damaging Het
Adam25 A T 8: 40,754,449 I251F probably damaging Het
Ankrd31 A T 13: 96,780,334 T119S probably damaging Het
Ankrd31 T C 13: 96,780,338 V120A possibly damaging Het
Anks6 T C 4: 47,016,789 E809G possibly damaging Het
Arhgap21 A T 2: 20,865,342 S928T probably damaging Het
Arhgef10l G T 4: 140,580,925 S39* probably null Het
Aspm G A 1: 139,480,994 E2540K probably benign Het
Atp10a T C 7: 58,658,591 I46T probably benign Het
Atp13a5 C A 16: 29,314,520 V483L possibly damaging Het
BC028528 T C 3: 95,889,770 D29G possibly damaging Het
Ccdc187 T A 2: 26,276,102 T772S possibly damaging Het
Ccnh G A 13: 85,202,402 A199T probably benign Het
Cfap65 A T 1: 74,905,051 Y1504N probably damaging Het
Ckap2 C A 8: 22,175,883 E383* probably null Het
Clec4n T C 6: 123,235,573 V116A possibly damaging Het
Cmc2 G T 8: 116,889,811 D58E unknown Het
Cntn6 A G 6: 104,804,347 K465E possibly damaging Het
Col6a6 G A 9: 105,783,860 A350V probably damaging Het
Cps1 A G 1: 67,180,152 I884V probably damaging Het
E2f7 C T 10: 110,784,681 A853V probably benign Het
E330034G19Rik A T 14: 24,296,792 Q114L unknown Het
Egfr G T 11: 16,887,155 G632V probably damaging Het
Fam98b T C 2: 117,249,769 M1T probably null Het
Fcgr2b T A 1: 170,961,088 I317F probably damaging Het
Galntl6 T C 8: 57,958,401 D265G probably damaging Het
Gm35911 C T 5: 99,923,093 P76S probably damaging Het
Gm4922 A G 10: 18,784,581 L131P probably damaging Het
H1fnt T C 15: 98,256,942 I109V probably benign Het
H2-Q1 A T 17: 35,321,373 I145F probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Ica1 A T 6: 8,667,288 S293T probably benign Het
Klra5 C A 6: 129,906,723 W147L possibly damaging Het
Magi2 G T 5: 20,466,178 V507F probably damaging Het
Malrd1 T C 2: 15,752,849 I978T unknown Het
Malrd1 G A 2: 15,797,726 W1083* probably null Het
Mgarp T C 3: 51,396,481 T10A probably damaging Het
Mtnr1a A G 8: 45,085,575 I17V Het
Muc5ac C T 7: 141,808,694 T1914I unknown Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nav3 T C 10: 110,000,003 T73A probably benign Het
Olfr1053 A T 2: 86,314,834 Y151N probably damaging Het
Olfr1270 A C 2: 90,149,476 C177G probably damaging Het
Pclo T A 5: 14,712,438 S357T probably benign Het
Pkdrej T A 15: 85,818,219 N1172I probably benign Het
Psmb9 G A 17: 34,183,104 R173C probably benign Het
Ralgapb T A 2: 158,473,152 H1146Q probably benign Het
Rcc1 A G 4: 132,334,763 S280P probably damaging Het
Recql T C 6: 142,374,891 M144V possibly damaging Het
Rela T C 19: 5,645,340 I298T probably damaging Het
Rfc1 T A 5: 65,274,431 I792F Het
Rnf31 A G 14: 55,596,152 E539G Het
Rrp9 T C 9: 106,483,641 S274P possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Scmh1 A G 4: 120,515,079 I360V probably benign Het
Sh3yl1 T C 12: 30,940,421 probably null Het
Shisa9 T C 16: 11,984,659 S27P probably benign Het
Slc17a4 A G 13: 23,901,927 V359A probably benign Het
Slfn5 C A 11: 82,960,059 A394E probably benign Het
Sun3 A G 11: 9,038,281 F14L probably benign Het
Surf1 A T 2: 26,914,796 D148E possibly damaging Het
Syne2 A G 12: 76,020,501 K4325E probably damaging Het
Syne2 A T 12: 76,095,070 K1388* probably null Het
Tacr1 A G 6: 82,554,872 M250V probably damaging Het
Tenm2 T C 11: 36,221,459 T420A probably benign Het
Tm7sf3 C A 6: 146,618,543 A282S probably benign Het
Tmf1 T C 6: 97,178,905 E40G probably benign Het
Tnfrsf12a A G 17: 23,676,517 probably null Het
Ttc30a2 T A 2: 75,976,468 I567F probably benign Het
Unc80 C A 1: 66,695,590 H3325Q possibly damaging Het
Zfp142 A G 1: 74,569,857 L1593S probably damaging Het
Zfp869 T A 8: 69,706,591 Y444F probably benign Het
Zscan10 G A 17: 23,607,645 probably null Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60525947 missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60502863 missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60489267 intron probably benign
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0048:Raph1 UTSW 1 60500605 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0049:Raph1 UTSW 1 60525899 missense probably benign 0.03
R0227:Raph1 UTSW 1 60525977 missense probably benign 0.00
R0387:Raph1 UTSW 1 60510496 intron probably benign
R0607:Raph1 UTSW 1 60525869 missense probably damaging 1.00
R1740:Raph1 UTSW 1 60519024 nonsense probably null
R2274:Raph1 UTSW 1 60498500 missense probably damaging 1.00
R3108:Raph1 UTSW 1 60493386 missense probably benign 0.01
R3977:Raph1 UTSW 1 60498523 missense probably benign 0.39
R4260:Raph1 UTSW 1 60502965 missense possibly damaging 0.94
R4487:Raph1 UTSW 1 60502869 missense possibly damaging 0.68
R4721:Raph1 UTSW 1 60503001 unclassified probably benign
R4782:Raph1 UTSW 1 60489114 missense probably damaging 1.00
R5027:Raph1 UTSW 1 60496277 missense probably damaging 1.00
R5037:Raph1 UTSW 1 60496222 splice site probably null
R5106:Raph1 UTSW 1 60533300 missense probably damaging 1.00
R5506:Raph1 UTSW 1 60493498 intron probably benign
R5510:Raph1 UTSW 1 60522946 unclassified probably benign
R5587:Raph1 UTSW 1 60498473 missense probably damaging 1.00
R5591:Raph1 UTSW 1 60501746 unclassified probably benign
R5619:Raph1 UTSW 1 60490255 intron probably benign
R5776:Raph1 UTSW 1 60490156 intron probably benign
R5802:Raph1 UTSW 1 60488673 missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60525720 missense probably damaging 0.97
R7122:Raph1 UTSW 1 60525977 missense probably benign 0.10
R7219:Raph1 UTSW 1 60502873 missense unknown
R7251:Raph1 UTSW 1 60489868 missense unknown
R7254:Raph1 UTSW 1 60499608 missense unknown
R7732:Raph1 UTSW 1 60533288 missense possibly damaging 0.82
R7979:Raph1 UTSW 1 60525989 missense probably benign 0.00
R7986:Raph1 UTSW 1 60496286 missense
R8167:Raph1 UTSW 1 60490111 missense unknown
R8168:Raph1 UTSW 1 60499620 missense unknown
R8399:Raph1 UTSW 1 60489318 missense unknown
R9036:Raph1 UTSW 1 60502965 missense unknown
R9146:Raph1 UTSW 1 60518978 critical splice donor site probably null
R9338:Raph1 UTSW 1 60490141 missense unknown
R9381:Raph1 UTSW 1 60501800 missense unknown
R9383:Raph1 UTSW 1 60525670 missense unknown
R9399:Raph1 UTSW 1 60525995 missense probably benign
R9561:Raph1 UTSW 1 60525728 missense possibly damaging 0.49
RF018:Raph1 UTSW 1 60489267 intron probably benign
RF022:Raph1 UTSW 1 60489267 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTTGCTGGCAGGGACTTTAG -3'
(R):5'- GTTCAGCACCTTCCTCAGAC -3'

Sequencing Primer
(F):5'- ACTTTAGGGGCTGAGAGTCCAC -3'
(R):5'- GCAACTGTCCCTCCTCAAG -3'
Posted On 2022-06-15