Mutagenetix > Incidental Mutation

Incidental Mutation 'R9454:Muc5ac'

714469

Institutional Source

Beutler Lab

Gene Symbol

Muc5ac

Ensembl Gene

ENSMUSG00000037974

Gene Name

mucin 5, subtypes A and C, tracheobronchial/gastric

Synonyms

MGM, 2210005L13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9454 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141788972-141819231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 141808694 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1914 (T1914I)

Ref Sequence

ENSEMBL: ENSMUSP00000122353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000041924

SMART Domains

Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	1.6e-14	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	6.1e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1482	2.3e-25	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1692	2.2e-27	PFAM
Pfam:Mucin2_WxxW	1765	1857	8.6e-27	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000155534
AA Change: T1914I

SMART Domains

Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: T1914I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	9.6e-15	PFAM
VWC	395	437	3.54e-1	SMART
VWD	422	586	2.35e-33	SMART
C8	623	697	8.42e-36	SMART
Pfam:TIL	703	760	3.6e-9	PFAM
VWC	762	826	6.75e-1	SMART
VWC	864	906	4.06e-1	SMART
VWD	891	1051	1.51e-45	SMART
C8	1087	1161	2.78e-36	SMART
low complexity region	1316	1331	N/A	INTRINSIC
low complexity region	1334	1367	N/A	INTRINSIC
low complexity region	1372	1388	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1395	1483	1.3e-25	PFAM
low complexity region	1522	1533	N/A	INTRINSIC
low complexity region	1537	1564	N/A	INTRINSIC
low complexity region	1579	1596	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1605	1693	1.3e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163321

SMART Domains

Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
VWD	69	226	4.19e-30	SMART
C8	258	334	1.34e-11	SMART
Pfam:TIL	337	393	7.9e-15	PFAM
VWC	395	462	8.6e-18	SMART
VWD	421	585	1.55e-33	SMART
C8	622	696	8.42e-36	SMART
Pfam:TIL	702	759	1.9e-9	PFAM
VWC	761	825	6.75e-1	SMART
VWC	863	905	4.06e-1	SMART
VWD	890	1050	1.51e-45	SMART
C8	1086	1160	2.78e-36	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1333	1366	N/A	INTRINSIC
low complexity region	1371	1387	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1394	1481	1.1e-23	PFAM
low complexity region	1521	1532	N/A	INTRINSIC
low complexity region	1536	1563	N/A	INTRINSIC
low complexity region	1578	1595	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1604	1691	1.1e-25	PFAM
Pfam:Mucin2_WxxW	1765	1856	6.3e-24	PFAM
low complexity region	1875	1895	N/A	INTRINSIC
low complexity region	1949	1968	N/A	INTRINSIC
VWD	2030	2199	4.17e-48	SMART
C8	2242	2311	3.95e-9	SMART
VWC	2376	2439	1.04e-11	SMART
VWC	2479	2543	9.31e-5	SMART
CT	2625	2711	3.43e-32	SMART
low complexity region	2720	2733	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim3	G	T	18: 61,818,996	H431Q	possibly damaging	Het
Adam25	A	T	8: 40,754,449	I251F	probably damaging	Het
Ankrd31	A	T	13: 96,780,334	T119S	probably damaging	Het
Ankrd31	T	C	13: 96,780,338	V120A	possibly damaging	Het
Anks6	T	C	4: 47,016,789	E809G	possibly damaging	Het
Arhgap21	A	T	2: 20,865,342	S928T	probably damaging	Het
Arhgef10l	G	T	4: 140,580,925	S39*	probably null	Het
Aspm	G	A	1: 139,480,994	E2540K	probably benign	Het
Atp10a	T	C	7: 58,658,591	I46T	probably benign	Het
Atp13a5	C	A	16: 29,314,520	V483L	possibly damaging	Het
BC028528	T	C	3: 95,889,770	D29G	possibly damaging	Het
Ccdc187	T	A	2: 26,276,102	T772S	possibly damaging	Het
Ccnh	G	A	13: 85,202,402	A199T	probably benign	Het
Cfap65	A	T	1: 74,905,051	Y1504N	probably damaging	Het
Ckap2	C	A	8: 22,175,883	E383*	probably null	Het
Clec4n	T	C	6: 123,235,573	V116A	possibly damaging	Het
Cmc2	G	T	8: 116,889,811	D58E	unknown	Het
Cntn6	A	G	6: 104,804,347	K465E	possibly damaging	Het
Col6a6	G	A	9: 105,783,860	A350V	probably damaging	Het
Cps1	A	G	1: 67,180,152	I884V	probably damaging	Het
E2f7	C	T	10: 110,784,681	A853V	probably benign	Het
E330034G19Rik	A	T	14: 24,296,792	Q114L	unknown	Het
Egfr	G	T	11: 16,887,155	G632V	probably damaging	Het
Fam98b	T	C	2: 117,249,769	M1T	probably null	Het
Fcgr2b	T	A	1: 170,961,088	I317F	probably damaging	Het
Galntl6	T	C	8: 57,958,401	D265G	probably damaging	Het
Gm35911	C	T	5: 99,923,093	P76S	probably damaging	Het
Gm4922	A	G	10: 18,784,581	L131P	probably damaging	Het
H1fnt	T	C	15: 98,256,942	I109V	probably benign	Het
H2-Q1	A	T	17: 35,321,373	I145F	probably damaging	Het
Heatr5a	AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA	AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA	12: 51,887,919		probably benign	Het
Ica1	A	T	6: 8,667,288	S293T	probably benign	Het
Klra5	C	A	6: 129,906,723	W147L	possibly damaging	Het
Magi2	G	T	5: 20,466,178	V507F	probably damaging	Het
Malrd1	T	C	2: 15,752,849	I978T	unknown	Het
Malrd1	G	A	2: 15,797,726	W1083*	probably null	Het
Mgarp	T	C	3: 51,396,481	T10A	probably damaging	Het
Mtnr1a	A	G	8: 45,085,575	I17V		Het
Naf1	GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC	GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC	8: 66,860,548		probably benign	Het
Nav3	T	C	10: 110,000,003	T73A	probably benign	Het
Olfr1053	A	T	2: 86,314,834	Y151N	probably damaging	Het
Olfr1270	A	C	2: 90,149,476	C177G	probably damaging	Het
Pclo	T	A	5: 14,712,438	S357T	probably benign	Het
Pkdrej	T	A	15: 85,818,219	N1172I	probably benign	Het
Psmb9	G	A	17: 34,183,104	R173C	probably benign	Het
Ralgapb	T	A	2: 158,473,152	H1146Q	probably benign	Het
Raph1	T	A	1: 60,489,594	Q836L	unknown	Het
Rcc1	A	G	4: 132,334,763	S280P	probably damaging	Het
Recql	T	C	6: 142,374,891	M144V	possibly damaging	Het
Rela	T	C	19: 5,645,340	I298T	probably damaging	Het
Rfc1	T	A	5: 65,274,431	I792F		Het
Rnf31	A	G	14: 55,596,152	E539G		Het
Rrp9	T	C	9: 106,483,641	S274P	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,923		probably benign	Het
Scmh1	A	G	4: 120,515,079	I360V	probably benign	Het
Sh3yl1	T	C	12: 30,940,421		probably null	Het
Shisa9	T	C	16: 11,984,659	S27P	probably benign	Het
Slc17a4	A	G	13: 23,901,927	V359A	probably benign	Het
Slfn5	C	A	11: 82,960,059	A394E	probably benign	Het
Sun3	A	G	11: 9,038,281	F14L	probably benign	Het
Surf1	A	T	2: 26,914,796	D148E	possibly damaging	Het
Syne2	A	G	12: 76,020,501	K4325E	probably damaging	Het
Syne2	A	T	12: 76,095,070	K1388*	probably null	Het
Tacr1	A	G	6: 82,554,872	M250V	probably damaging	Het
Tenm2	T	C	11: 36,221,459	T420A	probably benign	Het
Tm7sf3	C	A	6: 146,618,543	A282S	probably benign	Het
Tmf1	T	C	6: 97,178,905	E40G	probably benign	Het
Tnfrsf12a	A	G	17: 23,676,517		probably null	Het
Ttc30a2	T	A	2: 75,976,468	I567F	probably benign	Het
Unc80	C	A	1: 66,695,590	H3325Q	possibly damaging	Het
Zfp142	A	G	1: 74,569,857	L1593S	probably damaging	Het
Zfp869	T	A	8: 69,706,591	Y444F	probably benign	Het
Zscan10	G	A	17: 23,607,645		probably null	Het

Other mutations in Muc5ac

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Muc5ac	APN	7	141812703	missense	possibly damaging	0.93
IGL01064:Muc5ac	APN	7	141807473	missense	probably benign	0.12
IGL01155:Muc5ac	APN	7	141806943	splice site	probably benign
IGL01452:Muc5ac	APN	7	141817555	missense	probably benign	0.00
IGL01590:Muc5ac	APN	7	141798893	missense	probably benign	0.02
IGL02104:Muc5ac	APN	7	141811078	missense	probably damaging	0.98
IGL02152:Muc5ac	APN	7	141800177	missense	possibly damaging	0.86
IGL02153:Muc5ac	APN	7	141818800	nonsense	probably null
IGL02178:Muc5ac	APN	7	141805447	splice site	probably benign
IGL02403:Muc5ac	APN	7	141803450	missense	possibly damaging	0.71
IGL02576:Muc5ac	APN	7	141817044	missense	probably benign	0.01
IGL02665:Muc5ac	APN	7	141791086	missense	possibly damaging	0.71
IGL02704:Muc5ac	APN	7	141795263	missense	possibly damaging	0.71
IGL02808:Muc5ac	APN	7	141805775	missense	possibly damaging	0.72
IGL03283:Muc5ac	APN	7	141813781	missense	probably benign	0.34
IGL03384:Muc5ac	APN	7	141812403	missense	possibly damaging	0.71
IGL03046:Muc5ac	UTSW	7	141795213	missense	probably benign	0.27
PIT4515001:Muc5ac	UTSW	7	141807416	missense	probably damaging	0.99
R0092:Muc5ac	UTSW	7	141818630	missense	possibly damaging	0.72
R0145:Muc5ac	UTSW	7	141795275	missense	possibly damaging	0.71
R0147:Muc5ac	UTSW	7	141811039	missense	probably benign	0.08
R0363:Muc5ac	UTSW	7	141800960	missense	probably benign	0.01
R0384:Muc5ac	UTSW	7	141812251	missense	possibly damaging	0.71
R0440:Muc5ac	UTSW	7	141792034	nonsense	probably null
R0583:Muc5ac	UTSW	7	141807608	missense	probably damaging	0.99
R0616:Muc5ac	UTSW	7	141796244	missense	probably benign	0.02
R0682:Muc5ac	UTSW	7	141805669	missense	possibly damaging	0.53
R0685:Muc5ac	UTSW	7	141807709	missense	probably benign	0.03
R0883:Muc5ac	UTSW	7	141796265	missense	possibly damaging	0.71
R0924:Muc5ac	UTSW	7	141807515	missense	possibly damaging	0.68
R1300:Muc5ac	UTSW	7	141816929	missense	possibly damaging	0.73
R1315:Muc5ac	UTSW	7	141807323	missense	probably damaging	0.99
R1354:Muc5ac	UTSW	7	141807377	missense	probably damaging	0.99
R1484:Muc5ac	UTSW	7	141813892	splice site	probably null
R1599:Muc5ac	UTSW	7	141798903	missense	possibly damaging	0.52
R1758:Muc5ac	UTSW	7	141801531	missense	possibly damaging	0.86
R1837:Muc5ac	UTSW	7	141807086	missense	probably benign	0.00
R1911:Muc5ac	UTSW	7	141796304	missense	probably benign	0.18
R1922:Muc5ac	UTSW	7	141793689	missense	probably benign	0.03
R1966:Muc5ac	UTSW	7	141803376	missense	possibly damaging	0.92
R1994:Muc5ac	UTSW	7	141813152	missense	possibly damaging	0.93
R2056:Muc5ac	UTSW	7	141792035	missense	probably benign	0.01
R2126:Muc5ac	UTSW	7	141810742	missense	possibly damaging	0.84
R2170:Muc5ac	UTSW	7	141812347	missense	possibly damaging	0.93
R2258:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2259:Muc5ac	UTSW	7	141791008	missense	probably benign	0.41
R2293:Muc5ac	UTSW	7	141807199	missense	probably damaging	0.99
R2435:Muc5ac	UTSW	7	141818104	missense	possibly damaging	0.53
R2895:Muc5ac	UTSW	7	141791140	missense	possibly damaging	0.92
R2910:Muc5ac	UTSW	7	141807641	missense	probably damaging	0.99
R3154:Muc5ac	UTSW	7	141792736	splice site	probably null
R3762:Muc5ac	UTSW	7	141807475	missense	possibly damaging	0.53
R3791:Muc5ac	UTSW	7	141798501	missense	probably benign	0.32
R3806:Muc5ac	UTSW	7	141813734	missense	possibly damaging	0.91
R3825:Muc5ac	UTSW	7	141814723	missense	possibly damaging	0.92
R3888:Muc5ac	UTSW	7	141791224	missense	possibly damaging	0.51
R3929:Muc5ac	UTSW	7	141802892	missense	probably benign
R3981:Muc5ac	UTSW	7	141813775	missense	possibly damaging	0.86
R4034:Muc5ac	UTSW	7	141799844	critical splice donor site	probably null
R4043:Muc5ac	UTSW	7	141807478	missense	possibly damaging	0.53
R4061:Muc5ac	UTSW	7	141811130	missense	possibly damaging	0.85
R4106:Muc5ac	UTSW	7	141802835	missense	possibly damaging	0.86
R4206:Muc5ac	UTSW	7	141817110	missense	possibly damaging	0.73
R4613:Muc5ac	UTSW	7	141791103	missense	possibly damaging	0.93
R4719:Muc5ac	UTSW	7	141789763	missense	possibly damaging	0.83
R4751:Muc5ac	UTSW	7	141817601	missense	probably benign	0.00
R4789:Muc5ac	UTSW	7	141798882	missense	possibly damaging	0.86
R4928:Muc5ac	UTSW	7	141817902	nonsense	probably null
R4971:Muc5ac	UTSW	7	141816278	missense	possibly damaging	0.68
R4982:Muc5ac	UTSW	7	141809456	intron	probably benign
R5088:Muc5ac	UTSW	7	141796319	missense	possibly damaging	0.53
R5141:Muc5ac	UTSW	7	141814742	missense	possibly damaging	0.72
R5224:Muc5ac	UTSW	7	141793971	missense	probably benign	0.32
R5366:Muc5ac	UTSW	7	141807550	missense	probably benign	0.01
R5497:Muc5ac	UTSW	7	141807643	missense	probably damaging	0.99
R5507:Muc5ac	UTSW	7	141807832	missense	possibly damaging	0.72
R5643:Muc5ac	UTSW	7	141793715	critical splice donor site	probably null
R5811:Muc5ac	UTSW	7	141798984	missense	possibly damaging	0.51
R5946:Muc5ac	UTSW	7	141817907	missense	possibly damaging	0.73
R5970:Muc5ac	UTSW	7	141790669	nonsense	probably null
R5977:Muc5ac	UTSW	7	141796367	missense	possibly damaging	0.73
R6051:Muc5ac	UTSW	7	141811857	missense	possibly damaging	0.53
R6126:Muc5ac	UTSW	7	141801232	missense	possibly damaging	0.71
R6159:Muc5ac	UTSW	7	141815586	missense	possibly damaging	0.53
R6256:Muc5ac	UTSW	7	141789795	missense	possibly damaging	0.53
R6283:Muc5ac	UTSW	7	141816864	nonsense	probably null
R6341:Muc5ac	UTSW	7	141801492	missense	probably damaging	0.99
R6356:Muc5ac	UTSW	7	141812679	missense	probably benign	0.05
R6481:Muc5ac	UTSW	7	141809071	intron	probably benign
R6483:Muc5ac	UTSW	7	141802854	missense	probably benign	0.18
R6627:Muc5ac	UTSW	7	141808690	intron	probably benign
R6636:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6637:Muc5ac	UTSW	7	141818605	missense	possibly damaging	0.86
R6656:Muc5ac	UTSW	7	141803328	missense	probably damaging	0.98
R6721:Muc5ac	UTSW	7	141798992	missense	possibly damaging	0.71
R6794:Muc5ac	UTSW	7	141809552	intron	probably benign
R6844:Muc5ac	UTSW	7	141809744	intron	probably benign
R6847:Muc5ac	UTSW	7	141809744	intron	probably benign
R6852:Muc5ac	UTSW	7	141816907	missense	probably benign	0.03
R6862:Muc5ac	UTSW	7	141809744	intron	probably benign
R6863:Muc5ac	UTSW	7	141809744	intron	probably benign
R6864:Muc5ac	UTSW	7	141809744	intron	probably benign
R6865:Muc5ac	UTSW	7	141809744	intron	probably benign
R6874:Muc5ac	UTSW	7	141809744	intron	probably benign
R6875:Muc5ac	UTSW	7	141809744	intron	probably benign
R6876:Muc5ac	UTSW	7	141809744	intron	probably benign
R6877:Muc5ac	UTSW	7	141809744	intron	probably benign
R6889:Muc5ac	UTSW	7	141809744	intron	probably benign
R6920:Muc5ac	UTSW	7	141793298	missense	possibly damaging	0.86
R6998:Muc5ac	UTSW	7	141818714	missense	possibly damaging	0.92
R7017:Muc5ac	UTSW	7	141809687	intron	probably benign
R7091:Muc5ac	UTSW	7	141809687	intron	probably benign
R7092:Muc5ac	UTSW	7	141809648	intron	probably benign
R7092:Muc5ac	UTSW	7	141809687	intron	probably benign
R7110:Muc5ac	UTSW	7	141799822	missense	possibly damaging	0.95
R7117:Muc5ac	UTSW	7	141813822	nonsense	probably null
R7238:Muc5ac	UTSW	7	141809517	missense	unknown
R7238:Muc5ac	UTSW	7	141809687	intron	probably benign
R7396:Muc5ac	UTSW	7	141808415	missense	unknown
R7456:Muc5ac	UTSW	7	141793167	missense	probably benign	0.32
R7477:Muc5ac	UTSW	7	141816282	missense	possibly damaging	0.72
R7530:Muc5ac	UTSW	7	141813799	missense	possibly damaging	0.51
R7545:Muc5ac	UTSW	7	141808668	missense	unknown
R7604:Muc5ac	UTSW	7	141809709	missense	unknown
R7635:Muc5ac	UTSW	7	141805676	missense	probably damaging	0.98
R7635:Muc5ac	UTSW	7	141805753	missense	possibly damaging	0.53
R7650:Muc5ac	UTSW	7	141809422	missense	unknown
R7651:Muc5ac	UTSW	7	141796254	missense	possibly damaging	0.92
R7685:Muc5ac	UTSW	7	141809383	missense	unknown
R7720:Muc5ac	UTSW	7	141809303	missense	unknown
R7749:Muc5ac	UTSW	7	141809303	missense	unknown
R7750:Muc5ac	UTSW	7	141809303	missense	unknown
R7751:Muc5ac	UTSW	7	141809303	missense	unknown
R7754:Muc5ac	UTSW	7	141809303	missense	unknown
R7798:Muc5ac	UTSW	7	141794041	critical splice donor site	probably null
R7835:Muc5ac	UTSW	7	141809303	missense	unknown
R7837:Muc5ac	UTSW	7	141815963	missense	possibly damaging	0.53
R7858:Muc5ac	UTSW	7	141803429	missense	possibly damaging	0.51
R7866:Muc5ac	UTSW	7	141795852	missense	probably benign	0.00
R7874:Muc5ac	UTSW	7	141809303	missense	unknown
R7876:Muc5ac	UTSW	7	141809303	missense	unknown
R7877:Muc5ac	UTSW	7	141809303	missense	unknown
R7881:Muc5ac	UTSW	7	141809303	missense	unknown
R7884:Muc5ac	UTSW	7	141809303	missense	unknown
R7921:Muc5ac	UTSW	7	141809687	intron	probably benign
R7976:Muc5ac	UTSW	7	141809791	missense	unknown
R8104:Muc5ac	UTSW	7	141804783	missense	possibly damaging	0.96
R8177:Muc5ac	UTSW	7	141807331	missense	probably damaging	1.00
R8214:Muc5ac	UTSW	7	141802948	missense	possibly damaging	0.53
R8292:Muc5ac	UTSW	7	141809263	missense	unknown
R8386:Muc5ac	UTSW	7	141807634	missense	possibly damaging	0.93
R8400:Muc5ac	UTSW	7	141810476	missense	probably damaging	0.99
R8504:Muc5ac	UTSW	7	141807155	missense	probably damaging	1.00
R8709:Muc5ac	UTSW	7	141816926	missense	possibly damaging	0.96
R8725:Muc5ac	UTSW	7	141809744	intron	probably benign
R8727:Muc5ac	UTSW	7	141809744	intron	probably benign
R8754:Muc5ac	UTSW	7	141800271	missense	possibly damaging	0.85
R8769:Muc5ac	UTSW	7	141818872	missense	probably damaging	1.00
R8933:Muc5ac	UTSW	7	141789756	missense	possibly damaging	0.59
R8939:Muc5ac	UTSW	7	141793354	missense	probably damaging	0.98
R9049:Muc5ac	UTSW	7	141808975	missense	unknown
R9124:Muc5ac	UTSW	7	141809792	missense	unknown
R9131:Muc5ac	UTSW	7	141809792	missense	unknown
R9132:Muc5ac	UTSW	7	141809792	missense	unknown
R9135:Muc5ac	UTSW	7	141798481	missense	probably damaging	0.99
R9156:Muc5ac	UTSW	7	141809792	missense	unknown
R9157:Muc5ac	UTSW	7	141809792	missense	unknown
R9159:Muc5ac	UTSW	7	141809792	missense	unknown
R9160:Muc5ac	UTSW	7	141809792	missense	unknown
R9161:Muc5ac	UTSW	7	141799289	missense	possibly damaging	0.53
R9175:Muc5ac	UTSW	7	141812356	missense	possibly damaging	0.92
R9183:Muc5ac	UTSW	7	141798900	missense	possibly damaging	0.71
R9218:Muc5ac	UTSW	7	141807361	missense	probably damaging	0.99
R9219:Muc5ac	UTSW	7	141817063	nonsense	probably null
R9239:Muc5ac	UTSW	7	141800217	missense	probably damaging	0.99
R9246:Muc5ac	UTSW	7	141810478	missense	probably benign	0.11
R9287:Muc5ac	UTSW	7	141807889	missense	probably damaging	0.99
R9320:Muc5ac	UTSW	7	141815518	missense	probably benign	0.01
R9327:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
R9428:Muc5ac	UTSW	7	141808822	missense	unknown
R9430:Muc5ac	UTSW	7	141808832	missense	unknown
R9483:Muc5ac	UTSW	7	141811728	nonsense	probably null
R9581:Muc5ac	UTSW	7	141810062	missense	unknown
R9610:Muc5ac	UTSW	7	141796341	missense	possibly damaging	0.86
R9642:Muc5ac	UTSW	7	141795864	missense	possibly damaging	0.71
R9684:Muc5ac	UTSW	7	141811061	missense	probably benign	0.41
R9760:Muc5ac	UTSW	7	141807248	missense	probably benign	0.05
R9778:Muc5ac	UTSW	7	141795284	nonsense	probably null
X0060:Muc5ac	UTSW	7	141803333	missense	possibly damaging	0.71
Z1088:Muc5ac	UTSW	7	141809744	intron	probably benign
Z1088:Muc5ac	UTSW	7	141811692	missense	possibly damaging	0.86
Z1177:Muc5ac	UTSW	7	141809224	missense	unknown
Z1177:Muc5ac	UTSW	7	141818040	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- CTGCCACATTCCTGAAGGCT -3'
(R):5'- GCTGGCCTTTCCTGTATTGG -3'

Sequencing Primer
(F):5'- ATTCCTGAAGGCTGCTCCATGAC -3'
(R):5'- AGAGATGGTGCTGGTCTTTCC -3'

Posted On

2022-06-15