Incidental Mutation 'R0464:Wdr35'
ID71447
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene NameWD repeat domain 35
Synonyms4930459M12Rik
MMRRC Submission 038664-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0464 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location8973892-9028847 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 9027472 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085741] [ENSMUST00000085745] [ENSMUST00000111113] [ENSMUST00000219470] [ENSMUST00000219488]
Predicted Effect probably benign
Transcript: ENSMUST00000085741
SMART Domains Protein: ENSMUSP00000082891
Gene: ENSMUSG00000066637

DomainStartEndE-ValueType
Pfam:TPR_9 12 58 1.2e-2 PFAM
Pfam:TPR_12 51 121 1e-9 PFAM
Pfam:TPR_11 53 120 1.2e-14 PFAM
Pfam:TPR_1 55 88 3.5e-6 PFAM
Pfam:TPR_9 70 134 4.9e-7 PFAM
Pfam:TPR_1 90 122 1e-10 PFAM
Pfam:TPR_2 91 122 8.3e-11 PFAM
Pfam:TPR_8 91 122 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085745
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111113
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161019
Predicted Effect probably benign
Transcript: ENSMUST00000219470
Predicted Effect probably benign
Transcript: ENSMUST00000219488
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,112,437 L28P probably damaging Het
Ada G T 2: 163,732,964 Y84* probably null Het
Adar T A 3: 89,735,582 C257S possibly damaging Het
Adgrd1 G T 5: 129,162,650 C507F probably damaging Het
Atp5a1 T C 18: 77,779,922 Y299H probably benign Het
Bok G T 1: 93,694,213 R77L probably damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Ceacam1 A G 7: 25,472,017 S341P possibly damaging Het
Cfhr3 A T 1: 139,593,945 noncoding transcript Het
Ckap5 A G 2: 91,579,513 I947V probably benign Het
Clec2i T C 6: 128,895,423 Y173H probably damaging Het
Cttnbp2 T C 6: 18,408,691 D977G possibly damaging Het
Cyp2f2 C A 7: 27,132,537 Q406K probably benign Het
Ddx28 A G 8: 106,010,053 S458P probably damaging Het
Dppa3 T A 6: 122,628,533 probably null Het
Dusp10 C A 1: 184,069,076 L347I probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fbxl15 A T 19: 46,328,512 E13D probably benign Het
Fhit T A 14: 10,991,567 probably benign Het
Fras1 G T 5: 96,636,803 V882F probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gabbr1 C T 17: 37,050,834 probably benign Het
Ganc T A 2: 120,436,694 V497D probably benign Het
Glt8d2 T G 10: 82,654,730 H242P possibly damaging Het
Gm906 A G 13: 50,248,275 probably benign Het
Gna15 T C 10: 81,512,504 Y131C probably benign Het
Gpatch8 T C 11: 102,480,886 K609E unknown Het
Gprc5a A T 6: 135,079,415 K287* probably null Het
Iqub T A 6: 24,479,263 K427* probably null Het
Itpr2 C G 6: 146,375,889 D666H probably damaging Het
Kcnj5 T C 9: 32,322,973 I15M possibly damaging Het
Kcnn2 A G 18: 45,560,359 E334G probably damaging Het
Lypd6 T A 2: 50,190,678 I126N probably damaging Het
Mtus1 T C 8: 41,002,474 D56G probably damaging Het
Myo1h A G 5: 114,360,510 D889G probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nab1 T C 1: 52,490,015 D241G possibly damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Ncbp3 C T 11: 73,069,821 probably benign Het
Nek1 T A 8: 61,072,273 probably benign Het
Nf1 T C 11: 79,556,789 V2452A probably benign Het
Nlrp1b A C 11: 71,218,244 S144A probably damaging Het
Npr2 A T 4: 43,640,597 probably null Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC "TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC,TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC" X: 143,743,893 probably benign Het
Paox T A 7: 140,129,282 probably benign Het
Pcdh15 T A 10: 74,626,844 probably null Het
Pde8b G A 13: 95,104,698 T202M probably damaging Het
Pigo A T 4: 43,019,814 V905D probably benign Het
Pik3cb A G 9: 99,044,743 probably null Het
Rassf5 T C 1: 131,212,261 N87S probably benign Het
Rbl1 C A 2: 157,147,545 K1051N probably damaging Het
Rfx7 T C 9: 72,618,204 V892A probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
Rnf144b T A 13: 47,242,887 Y233* probably null Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sbf2 T C 7: 110,464,576 probably benign Het
Sgo2a A T 1: 58,000,094 K85N probably damaging Het
Siglec1 A T 2: 131,079,359 C631S probably damaging Het
Simc1 C T 13: 54,537,100 R50* probably null Het
Skint5 T A 4: 113,535,731 M1235L unknown Het
Slc22a19 A T 19: 7,682,913 N377K probably benign Het
Spata31d1a A G 13: 59,701,759 F852L possibly damaging Het
Srbd1 G A 17: 86,120,002 S401F probably damaging Het
Stk36 C A 1: 74,611,172 Q288K probably damaging Het
Styx T C 14: 45,372,451 S191P probably benign Het
Supt6 T A 11: 78,216,338 N1214I probably benign Het
Tcim T A 8: 24,438,628 D90V probably damaging Het
Tdpoz1 T A 3: 93,671,475 M1L probably damaging Het
Tep1 T A 14: 50,847,684 T881S probably benign Het
Tlr5 C T 1: 182,973,710 A193V probably benign Het
Tmem117 T A 15: 94,714,919 F112Y probably damaging Het
Tnrc6c C T 11: 117,760,549 R1633W probably damaging Het
Trh T C 6: 92,243,668 probably null Het
Triobp A G 15: 78,966,986 R447G possibly damaging Het
Trip6 A G 5: 137,313,681 F46S probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Usp33 T C 3: 152,376,235 probably benign Het
Vmn2r60 A T 7: 42,135,831 I156F probably damaging Het
Wdr17 T C 8: 54,670,392 probably benign Het
Wwp1 C T 4: 19,638,763 probably benign Het
Zfp652 T C 11: 95,763,649 C293R probably damaging Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R8289:Wdr35 UTSW 12 9008020 missense probably benign 0.00
R8302:Wdr35 UTSW 12 9028110 missense probably benign 0.09
R8433:Wdr35 UTSW 12 9008495 missense probably damaging 1.00
R8479:Wdr35 UTSW 12 8985985 missense probably benign 0.04
R8498:Wdr35 UTSW 12 9008626 missense probably damaging 0.97
R8721:Wdr35 UTSW 12 9025044 critical splice donor site probably null
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTTCACCTTGTCTGGAATGCCAC -3'
(R):5'- GCTCTGCACTGAGCGTCTCTAAAG -3'

Sequencing Primer
(F):5'- CAGTATGGAAACCATTCGGTCTG -3'
(R):5'- CTGAGCGTCTCTAAAGATTCCAG -3'
Posted On2013-09-30