Incidental Mutation 'R9455:Myom2'
ID 714535
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Name myomesin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R9455 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 15057653-15133541 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15106293 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 713 (H713Q)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
AlphaFold Q14BI5
Predicted Effect probably benign
Transcript: ENSMUST00000033842
AA Change: H713Q

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: H713Q

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,403,897 Y3740H probably damaging Het
Acsl6 G T 11: 54,319,926 probably benign Het
Adamts5 C T 16: 85,870,129 D492N probably damaging Het
Als2 T C 1: 59,180,137 E1218G probably damaging Het
BC055324 G T 1: 163,954,152 T902K probably benign Het
Bcl2l15 C T 3: 103,836,053 T90I unknown Het
Bsn A G 9: 108,111,332 V2407A unknown Het
Casp8ap2 T C 4: 32,643,924 M999T possibly damaging Het
Ccdc66 G A 14: 27,486,915 P461S probably benign Het
Cd46 G A 1: 195,062,396 L345F possibly damaging Het
Cep295 A T 9: 15,333,750 S1137T possibly damaging Het
Chd7 A G 4: 8,752,061 Y186C unknown Het
Clca3b T A 3: 144,823,262 T884S unknown Het
Cndp2 T A 18: 84,672,121 Y232F probably benign Het
Cx3cr1 A T 9: 120,051,593 Y248N probably damaging Het
Dnm3 A T 1: 162,320,955 N282K possibly damaging Het
Emilin2 T C 17: 71,274,490 I414V probably benign Het
F3 A T 3: 121,734,217 N288I probably damaging Het
Fat4 T C 3: 38,891,263 L1435P Het
Fbxw14 A T 9: 109,274,499 N371K probably benign Het
Fn1 T A 1: 71,607,953 E1559D probably benign Het
Frrs1 T A 3: 116,902,323 M497K possibly damaging Het
Gm45861 C T 8: 27,551,366 Q1000* probably null Het
Gm5415 A T 1: 32,546,826 M1K probably null Het
Gpr152 T C 19: 4,143,845 S462P probably benign Het
Irgq A G 7: 24,531,792 N136S probably benign Het
Kdm2b T C 5: 122,961,474 Y134C probably damaging Het
Klf12 A T 14: 100,109,790 L35H probably damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Ksr1 A T 11: 79,020,776 C727S possibly damaging Het
Lpin3 G T 2: 160,895,339 R102L probably benign Het
Ltv1 T C 10: 13,182,373 E229G probably damaging Het
Ly6f T A 15: 75,269,799 Y30* probably null Het
Map2k7 C G 8: 4,243,957 R168G probably damaging Het
Mep1a T C 17: 43,494,976 E100G probably benign Het
Mrgpra6 T A 7: 47,189,219 Y46F probably damaging Het
Mroh6 C A 15: 75,888,056 R143L probably benign Het
Ndn C T 7: 62,348,589 P61L possibly damaging Het
Olfr65 G T 7: 103,906,993 V182F Het
Pear1 T A 3: 87,759,181 T72S possibly damaging Het
Sel1l3 T A 5: 53,131,815 N888I probably damaging Het
Sell A T 1: 164,066,649 T171S probably benign Het
Sin3b G T 8: 72,724,053 A37S possibly damaging Het
Sipa1l1 T C 12: 82,387,625 F723S probably damaging Het
Slc26a8 T C 17: 28,644,614 T724A probably damaging Het
Slc51a T G 16: 32,486,195 N25H probably damaging Het
Slc9a4 T C 1: 40,629,452 F752L probably benign Het
Slco4a1 A C 2: 180,473,577 D649A probably benign Het
Tax1bp1 T A 6: 52,766,044 H805Q probably damaging Het
Tgfb1i1 T C 7: 128,252,837 F303L probably damaging Het
Tsg101 A T 7: 46,913,403 D34E probably damaging Het
Tspoap1 T C 11: 87,770,533 S604P probably damaging Het
Ttll2 C A 17: 7,352,293 W78C probably damaging Het
Ttn A G 2: 76,918,990 F3905S possibly damaging Het
Txnrd2 G T 16: 18,429,865 C57F probably damaging Het
Vcan A T 13: 89,689,333 D2697E probably damaging Het
Vwa8 G A 14: 79,062,675 V983I probably damaging Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
yomama UTSW 8 15132895 missense probably benign 0.10
yoyoma UTSW 8 15132667 missense probably damaging 0.99
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 splice site probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7690:Myom2 UTSW 8 15111717 critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15083259 missense probably damaging 1.00
R7822:Myom2 UTSW 8 15108454 missense probably benign
R7948:Myom2 UTSW 8 15085306 missense probably benign 0.00
R8094:Myom2 UTSW 8 15069418 missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15129157 missense probably damaging 1.00
R8292:Myom2 UTSW 8 15132888 missense probably benign 0.01
R8514:Myom2 UTSW 8 15125153 missense possibly damaging 0.65
R8539:Myom2 UTSW 8 15114254 missense probably benign 0.01
R8790:Myom2 UTSW 8 15119242 missense probably damaging 1.00
R8824:Myom2 UTSW 8 15114169 missense possibly damaging 0.82
R8895:Myom2 UTSW 8 15102589 nonsense probably null
R9024:Myom2 UTSW 8 15063936 missense probably damaging 1.00
R9129:Myom2 UTSW 8 15104068 missense probably damaging 1.00
R9224:Myom2 UTSW 8 15128804 missense possibly damaging 0.89
R9237:Myom2 UTSW 8 15102591 missense possibly damaging 0.85
R9321:Myom2 UTSW 8 15122464 missense possibly damaging 0.91
R9341:Myom2 UTSW 8 15084633 missense probably damaging 0.97
R9343:Myom2 UTSW 8 15084633 missense probably damaging 0.97
R9375:Myom2 UTSW 8 15099210 missense probably damaging 1.00
R9563:Myom2 UTSW 8 15108399 nonsense probably null
R9565:Myom2 UTSW 8 15108399 nonsense probably null
RF001:Myom2 UTSW 8 15081418 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GGGCATACTCCCAAGCTTGTTG -3'
(R):5'- AGTCCAGCCCAAACGTCTAG -3'

Sequencing Primer
(F):5'- CAAGCTTGTTGGGGAAGGC -3'
(R):5'- AACCAACCGTTAAGATCCTCTCTTTG -3'
Posted On 2022-06-15