Incidental Mutation 'R9456:Clcn2'
ID 714606
Institutional Source Beutler Lab
Gene Symbol Clcn2
Ensembl Gene ENSMUSG00000022843
Gene Name chloride channel, voltage-sensitive 2
Synonyms ClC-2, nmf240, Clc2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.378) question?
Stock # R9456 (G1)
Quality Score 146.467
Status Not validated
Chromosome 16
Chromosomal Location 20702964-20717746 bp(-) (GRCm38)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) CCCGCCGCCGCCGCCGC to CCCGCCGCCGCCGC at 20715952 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007207] [ENSMUST00000021405] [ENSMUST00000120099] [ENSMUST00000131522] [ENSMUST00000161038] [ENSMUST00000231392] [ENSMUST00000231656] [ENSMUST00000232309]
AlphaFold Q9R0A1
Predicted Effect probably benign
Transcript: ENSMUST00000007207
SMART Domains Protein: ENSMUSP00000007207
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 555 1.2e-94 PFAM
Blast:CBS 595 644 3e-12 BLAST
low complexity region 666 680 N/A INTRINSIC
CBS 803 850 3.69e0 SMART
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021405
SMART Domains Protein: ENSMUSP00000021405
Gene: ENSMUSG00000021018

DomainStartEndE-ValueType
RPOL8c 2 147 5.28e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120099
SMART Domains Protein: ENSMUSP00000112759
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 538 5.6e-77 PFAM
Blast:CBS 578 627 4e-12 BLAST
low complexity region 649 663 N/A INTRINSIC
CBS 786 833 3.69e0 SMART
low complexity region 852 864 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131522
SMART Domains Protein: ENSMUSP00000122921
Gene: ENSMUSG00000022843

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 102 111 N/A INTRINSIC
Pfam:Voltage_CLC 151 473 4.2e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153075
Predicted Effect probably benign
Transcript: ENSMUST00000161038
Predicted Effect probably benign
Transcript: ENSMUST00000231381
Predicted Effect probably benign
Transcript: ENSMUST00000231392
Predicted Effect probably benign
Transcript: ENSMUST00000231656
Predicted Effect probably benign
Transcript: ENSMUST00000232309
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated chloride channel. The encoded protein is a transmembrane protein that maintains chloride ion homeostasis in various cells. Defects in this gene may be a cause of certain epilepsies. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal brain morphology, male infertility, and abnormal eye morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,338,230 V410A probably damaging Het
Abhd3 T C 18: 10,645,121 D391G probably benign Het
Arhgdia A C 11: 120,579,242 W202G probably damaging Het
Atp2a3 A T 11: 72,980,305 D575V probably benign Het
Cep350 C A 1: 155,868,711 V2121L probably benign Het
Cldn9 A T 17: 23,683,582 V23E probably damaging Het
Cltc G A 11: 86,702,411 S1542F probably benign Het
Cmbl A G 15: 31,589,802 D226G probably damaging Het
Dennd4b C T 3: 90,271,208 T537I probably damaging Het
Dnah7b C A 1: 46,126,793 D539E possibly damaging Het
Fam219a T C 4: 41,521,871 T70A probably damaging Het
Fat4 T A 3: 38,888,422 V488E possibly damaging Het
Gm3336 A G 8: 70,722,091 *96W probably null Het
Hectd1 A G 12: 51,785,801 I930T probably benign Het
Hmcn1 A T 1: 150,630,302 C3824* probably null Het
Ift140 T C 17: 25,035,784 F413L probably benign Het
Itfg1 A G 8: 85,838,937 V90A probably benign Het
Jph4 A T 14: 55,113,633 W309R probably damaging Het
Kdm2a C T 19: 4,343,113 D405N Het
Klhl5 T C 5: 65,148,596 F302S probably damaging Het
Klk8 T C 7: 43,803,753 M256T probably benign Het
Klre1 A T 6: 129,582,405 R99S probably benign Het
Krt79 T C 15: 101,931,469 T364A probably benign Het
Lin7a C T 10: 107,382,622 P131L possibly damaging Het
Lrrc49 A G 9: 60,687,416 Y9H probably benign Het
Lrrc8a T A 2: 30,255,651 I159N probably damaging Het
Mdga2 T C 12: 66,568,758 S692G probably benign Het
Myo15 G A 11: 60,501,842 V1017M Het
Nol4 T C 18: 23,039,840 D68G probably benign Het
Olfr1276 T C 2: 111,258,003 V296A probably benign Het
Olfr790 T C 10: 129,501,646 V254A probably damaging Het
Pigw C A 11: 84,877,214 A430S probably benign Het
Pla2g4c T C 7: 13,343,975 L356P probably damaging Het
Prr5 A G 15: 84,701,481 T226A probably benign Het
Pygo1 C T 9: 72,925,774 probably benign Het
Rnf214 A G 9: 45,867,988 I333T possibly damaging Het
Sept3 A G 15: 82,283,151 I86V probably benign Het
Slc30a3 AGGGCTTACCTGAGCGG AGG 5: 31,089,545 probably null Het
Socs5 C A 17: 87,134,838 T402K probably damaging Het
Speer3 T A 5: 13,796,354 N229K Het
Stk16 T C 1: 75,211,160 probably benign Het
Taar7d T A 10: 24,027,389 F56L probably benign Het
Tcrg-V7 A T 13: 19,178,215 R25* probably null Het
Tmprss2 C T 16: 97,591,469 V93I probably benign Het
Tnpo2 G A 8: 85,047,386 E350K probably benign Het
Tor1aip2 C T 1: 156,061,779 P87S possibly damaging Het
Ush2a A G 1: 188,826,392 E3606G probably benign Het
Zeb1 C T 18: 5,766,709 Q407* probably null Het
Zfp609 A G 9: 65,703,843 S613P Het
Zfp735 A G 11: 73,711,577 N449S possibly damaging Het
Other mutations in Clcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Clcn2 APN 16 20703641 missense probably benign 0.08
IGL01657:Clcn2 APN 16 20713619 missense probably damaging 1.00
IGL01797:Clcn2 APN 16 20712761 missense probably damaging 1.00
IGL02557:Clcn2 APN 16 20708464 missense probably damaging 1.00
IGL02624:Clcn2 APN 16 20703348 missense probably damaging 0.98
IGL02819:Clcn2 APN 16 20709256 nonsense probably null
IGL03329:Clcn2 APN 16 20712152 missense probably damaging 1.00
Bemr14 UTSW 16 unclassified
R0008:Clcn2 UTSW 16 20710390 missense probably null 1.00
R0454:Clcn2 UTSW 16 20710428 critical splice acceptor site probably null
R1101:Clcn2 UTSW 16 20703595 missense probably damaging 1.00
R1466:Clcn2 UTSW 16 20712552 splice site probably benign
R1824:Clcn2 UTSW 16 20715962 missense probably benign 0.04
R4592:Clcn2 UTSW 16 20709142 missense probably damaging 0.99
R5011:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5013:Clcn2 UTSW 16 20707215 missense probably damaging 1.00
R5154:Clcn2 UTSW 16 20703303 missense probably benign 0.01
R5374:Clcn2 UTSW 16 20709669 missense possibly damaging 0.78
R5726:Clcn2 UTSW 16 20710535 intron probably benign
R5787:Clcn2 UTSW 16 20703433 missense probably damaging 1.00
R5992:Clcn2 UTSW 16 20713654 missense possibly damaging 0.68
R6045:Clcn2 UTSW 16 20711688 critical splice donor site probably null
R6663:Clcn2 UTSW 16 20703245 makesense probably null
R6765:Clcn2 UTSW 16 20707668 splice site probably null
R6825:Clcn2 UTSW 16 20709658 utr 3 prime probably benign
R7872:Clcn2 UTSW 16 20708460 missense probably damaging 0.99
R8028:Clcn2 UTSW 16 20708762 missense possibly damaging 0.66
R8198:Clcn2 UTSW 16 20707196 missense probably damaging 0.99
R8805:Clcn2 UTSW 16 20713418 missense probably damaging 1.00
R8924:Clcn2 UTSW 16 20712180 missense probably damaging 1.00
R8992:Clcn2 UTSW 16 20712330 missense probably damaging 1.00
R9074:Clcn2 UTSW 16 20712664 missense possibly damaging 0.78
R9101:Clcn2 UTSW 16 20707229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCGAACCTCAGTTTCCATAG -3'
(R):5'- AGATCGTGTTTCAAGCGCCC -3'

Sequencing Primer
(F):5'- CCTCAGTTTCCATAGCTGAGAAAGG -3'
(R):5'- TCTCCGGACACCAGGAG -3'
Posted On 2022-06-15