Incidental Mutation 'R9456:Cldn9'
ID 714608
Institutional Source Beutler Lab
Gene Symbol Cldn9
Ensembl Gene ENSMUSG00000066720
Gene Name claudin 9
Synonyms nmf329
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock # R9456 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23682584-23684018 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23683582 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 23 (V23E)
Ref Sequence ENSEMBL: ENSMUSP00000093236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024699] [ENSMUST00000085989]
AlphaFold Q9Z0S7
Predicted Effect probably benign
Transcript: ENSMUST00000024699
SMART Domains Protein: ENSMUSP00000024699
Gene: ENSMUSG00000023906

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 2.5e-35 PFAM
Pfam:Claudin_2 15 183 1.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085989
AA Change: V23E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093236
Gene: ENSMUSG00000066720
AA Change: V23E

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 181 9.7e-35 PFAM
Pfam:Claudin_2 15 183 8.1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This intronless gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is developmentally regulated; it is expressed in neonate kidney, but disappers by adulthood. It is required for the preservation of sensory cells in the hearing organ and the gene deficiency is associated with deafness. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit severe and early hearing loss associated with degeneration of outer hair cells and increased perilymph potassium ion concentration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,338,230 V410A probably damaging Het
Abhd3 T C 18: 10,645,121 D391G probably benign Het
Arhgdia A C 11: 120,579,242 W202G probably damaging Het
Atp2a3 A T 11: 72,980,305 D575V probably benign Het
Cep350 C A 1: 155,868,711 V2121L probably benign Het
Clcn2 CCCGCCGCCGCCGCCGC CCCGCCGCCGCCGC 16: 20,715,952 probably benign Het
Cltc G A 11: 86,702,411 S1542F probably benign Het
Cmbl A G 15: 31,589,802 D226G probably damaging Het
Dennd4b C T 3: 90,271,208 T537I probably damaging Het
Dnah7b C A 1: 46,126,793 D539E possibly damaging Het
Fam219a T C 4: 41,521,871 T70A probably damaging Het
Fat4 T A 3: 38,888,422 V488E possibly damaging Het
Gm3336 A G 8: 70,722,091 *96W probably null Het
Hectd1 A G 12: 51,785,801 I930T probably benign Het
Hmcn1 A T 1: 150,630,302 C3824* probably null Het
Ift140 T C 17: 25,035,784 F413L probably benign Het
Itfg1 A G 8: 85,838,937 V90A probably benign Het
Jph4 A T 14: 55,113,633 W309R probably damaging Het
Kdm2a C T 19: 4,343,113 D405N Het
Klhl5 T C 5: 65,148,596 F302S probably damaging Het
Klk8 T C 7: 43,803,753 M256T probably benign Het
Klre1 A T 6: 129,582,405 R99S probably benign Het
Krt79 T C 15: 101,931,469 T364A probably benign Het
Lin7a C T 10: 107,382,622 P131L possibly damaging Het
Lrrc49 A G 9: 60,687,416 Y9H probably benign Het
Lrrc8a T A 2: 30,255,651 I159N probably damaging Het
Mdga2 T C 12: 66,568,758 S692G probably benign Het
Myo15 G A 11: 60,501,842 V1017M Het
Nol4 T C 18: 23,039,840 D68G probably benign Het
Olfr1276 T C 2: 111,258,003 V296A probably benign Het
Olfr790 T C 10: 129,501,646 V254A probably damaging Het
Pigw C A 11: 84,877,214 A430S probably benign Het
Pla2g4c T C 7: 13,343,975 L356P probably damaging Het
Prr5 A G 15: 84,701,481 T226A probably benign Het
Pygo1 C T 9: 72,925,774 probably benign Het
Rnf214 A G 9: 45,867,988 I333T possibly damaging Het
Sept3 A G 15: 82,283,151 I86V probably benign Het
Slc30a3 AGGGCTTACCTGAGCGG AGG 5: 31,089,545 probably null Het
Socs5 C A 17: 87,134,838 T402K probably damaging Het
Speer3 T A 5: 13,796,354 N229K Het
Stk16 T C 1: 75,211,160 probably benign Het
Taar7d T A 10: 24,027,389 F56L probably benign Het
Tcrg-V7 A T 13: 19,178,215 R25* probably null Het
Tmprss2 C T 16: 97,591,469 V93I probably benign Het
Tnpo2 G A 8: 85,047,386 E350K probably benign Het
Tor1aip2 C T 1: 156,061,779 P87S possibly damaging Het
Ush2a A G 1: 188,826,392 E3606G probably benign Het
Zeb1 C T 18: 5,766,709 Q407* probably null Het
Zfp609 A G 9: 65,703,843 S613P Het
Zfp735 A G 11: 73,711,577 N449S possibly damaging Het
Other mutations in Cldn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1687:Cldn9 UTSW 17 23683076 missense probably benign 0.00
R4195:Cldn9 UTSW 17 23683174 missense probably damaging 1.00
R5710:Cldn9 UTSW 17 23683447 missense probably damaging 1.00
R6676:Cldn9 UTSW 17 23683049 missense probably benign 0.00
R7007:Cldn9 UTSW 17 23683078 missense probably benign
R7336:Cldn9 UTSW 17 23683015 missense probably benign 0.27
Z1177:Cldn9 UTSW 17 23683201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTACGATACGGGCCTTG -3'
(R):5'- GGTCTGAGATCAACAGATCCCC -3'

Sequencing Primer
(F):5'- ATACGGGCCTTGGCACCTTC -3'
(R):5'- AGATCCCCCTCCTGAGCAG -3'
Posted On 2022-06-15