Incidental Mutation 'R9457:Col5a2'
ID 714615
Institutional Source Beutler Lab
Gene Symbol Col5a2
Ensembl Gene ENSMUSG00000026042
Gene Name collagen, type V, alpha 2
Synonyms 1110014L14Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 45413491-45542442 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45426004 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1062 (V1062I)
Ref Sequence ENSEMBL: ENSMUSP00000083620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086430]
AlphaFold Q3U962
Predicted Effect probably benign
Transcript: ENSMUST00000086430
AA Change: V1062I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083620
Gene: ENSMUSG00000026042
AA Change: V1062I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 40 95 9.94e-23 SMART
Pfam:Collagen 123 186 1.5e-10 PFAM
Pfam:Collagen 207 272 2.9e-9 PFAM
low complexity region 319 347 N/A INTRINSIC
internal_repeat_1 349 421 3.18e-18 PROSPERO
internal_repeat_2 385 422 1.34e-12 PROSPERO
internal_repeat_5 388 423 1.55e-7 PROSPERO
low complexity region 424 460 N/A INTRINSIC
low complexity region 471 508 N/A INTRINSIC
internal_repeat_6 509 535 5.68e-7 PROSPERO
internal_repeat_2 511 548 1.34e-12 PROSPERO
internal_repeat_3 520 549 1.16e-11 PROSPERO
internal_repeat_1 520 571 3.18e-18 PROSPERO
internal_repeat_4 546 574 4.91e-9 PROSPERO
low complexity region 595 611 N/A INTRINSIC
internal_repeat_7 616 741 1.35e-6 PROSPERO
low complexity region 742 757 N/A INTRINSIC
Pfam:Collagen 790 870 4.8e-8 PFAM
low complexity region 877 898 N/A INTRINSIC
Pfam:Collagen 907 979 4.2e-8 PFAM
internal_repeat_4 993 1021 4.91e-9 PROSPERO
internal_repeat_3 994 1023 1.16e-11 PROSPERO
low complexity region 1024 1054 N/A INTRINSIC
internal_repeat_6 1055 1078 5.68e-7 PROSPERO
low complexity region 1081 1096 N/A INTRINSIC
Pfam:Collagen 1111 1171 9.7e-12 PFAM
Pfam:Collagen 1168 1230 1.4e-9 PFAM
COLFI 1263 1497 1.83e-164 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type V collagen, one of the low abundance fibrillar collagens that gets incorporated into growing fibrils with type I collagen. The encoded protein, in association with alpha-1 and/or alpha-3 subunits, forms homo- or heterotrimeric type V procollagen that undergoes proteolytic processing. Mice lacking the encoded protein die in utero. Transgenic mice that produce a structurally abnormal form of the encoded protein survive poorly and exhibit skin fragility, skeletal abnormalities and alterations in the collagen fiber organization. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals exhibit reduced body weight, reduced bone growth rate, thin, fragile skin, variable degrees of lordosis and kyphosis, abnormal localization of hair follicles in the dermis, and thinned stroma of the cornea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik T C 10: 115,414,236 (GRCm39) L54P unknown Het
Ablim3 A G 18: 61,978,920 (GRCm39) S204P probably benign Het
Acadl A G 1: 66,892,400 (GRCm39) V141A probably benign Het
Ace3 A G 11: 105,885,687 (GRCm39) D31G probably benign Het
Acte1 T C 7: 143,437,713 (GRCm39) V137A possibly damaging Het
Adam11 T G 11: 102,660,724 (GRCm39) V85G probably benign Het
Adarb1 A T 10: 77,157,982 (GRCm39) M155K possibly damaging Het
Arhgap10 G A 8: 78,111,415 (GRCm39) T376M probably benign Het
Bod1l G T 5: 41,979,310 (GRCm39) T668K probably damaging Het
Ccdc87 A G 19: 4,891,659 (GRCm39) E717G probably damaging Het
Cdh17 T A 4: 11,771,329 (GRCm39) I37N probably damaging Het
Cfap99 T G 5: 34,458,741 (GRCm39) F45L probably benign Het
Chsy1 C A 7: 65,822,148 (GRCm39) H794Q probably benign Het
Clec4a3 G A 6: 122,931,045 (GRCm39) V45I probably benign Het
Clic3 G A 2: 25,347,730 (GRCm39) V32I probably benign Het
Clip2 A T 5: 134,531,584 (GRCm39) D740E probably benign Het
Cyp2j11 C T 4: 96,195,596 (GRCm39) V367I probably damaging Het
Ddr1 C T 17: 35,993,650 (GRCm39) A821T possibly damaging Het
Dna2 G A 10: 62,786,572 (GRCm39) E107K probably benign Het
Eif3d A G 15: 77,843,894 (GRCm39) V484A probably benign Het
Fgfr4 A G 13: 55,308,940 (GRCm39) T354A probably benign Het
Fkbp6 T C 5: 135,378,486 (GRCm39) D54G probably benign Het
Gm4787 T A 12: 81,426,020 (GRCm39) E46V probably damaging Het
Gm47995 A G 1: 151,074,226 (GRCm39) T10A possibly damaging Het
Gnb1l T A 16: 18,359,745 (GRCm39) I50N probably damaging Het
Gphb5 A T 12: 75,462,523 (GRCm39) V22D probably damaging Het
Gstt4 C T 10: 75,650,959 (GRCm39) C221Y probably benign Het
Hmces T C 6: 87,910,256 (GRCm39) V222A possibly damaging Het
Kat14 T A 2: 144,215,702 (GRCm39) D62E probably benign Het
Kcnmb2 T A 3: 32,236,018 (GRCm39) V89E probably benign Het
Kif23 T A 9: 61,851,507 (GRCm39) N63I probably benign Het
Lamc2 T C 1: 153,015,600 (GRCm39) M578V probably benign Het
Ltbp2 A T 12: 84,835,927 (GRCm39) C1335S probably benign Het
Lyst A G 13: 13,862,330 (GRCm39) E2622G possibly damaging Het
Mctp1 A T 13: 76,532,793 (GRCm39) H47L probably benign Het
Mical2 A G 7: 112,010,665 (GRCm39) K618R probably damaging Het
Mllt6 T C 11: 97,556,586 (GRCm39) I92T probably benign Het
Morc2a A G 11: 3,626,184 (GRCm39) I223V probably benign Het
Msh3 A T 13: 92,481,594 (GRCm39) I306N probably benign Het
Myo3b T A 2: 69,925,553 (GRCm39) S35T probably benign Het
Nfkbiz A T 16: 55,634,347 (GRCm39) V700E probably damaging Het
Oit3 T A 10: 59,277,505 (GRCm39) M1L unknown Het
Or4c1 A T 2: 89,133,075 (GRCm39) I287N probably damaging Het
Or51l14 T A 7: 103,100,618 (GRCm39) F25I probably benign Het
Or8k17 A T 2: 86,066,816 (GRCm39) I114K probably damaging Het
Peg3 T G 7: 6,710,998 (GRCm39) D1408A probably damaging Het
Plaa A C 4: 94,475,120 (GRCm39) S201R possibly damaging Het
Potefam1 A T 2: 111,000,631 (GRCm39) M196K unknown Het
Psmd5 A G 2: 34,744,338 (GRCm39) S395P probably benign Het
Ralgapa2 T C 2: 146,176,474 (GRCm39) I1701V probably damaging Het
Rmc1 A G 18: 12,312,303 (GRCm39) H181R probably benign Het
Rnf32 G A 5: 29,411,184 (GRCm39) A157T probably damaging Het
Rrad T A 8: 105,356,359 (GRCm39) probably null Het
Samm50 T A 15: 84,092,042 (GRCm39) L339Q probably damaging Het
Scin T C 12: 40,154,957 (GRCm39) E212G possibly damaging Het
Scrib T C 15: 75,939,148 (GRCm39) D146G probably damaging Het
Slc19a1 G A 10: 76,885,605 (GRCm39) D502N probably benign Het
Slc4a4 T C 5: 89,362,432 (GRCm39) S839P probably damaging Het
Slc4a8 A G 15: 100,704,141 (GRCm39) D764G probably damaging Het
Slc6a19 G A 13: 73,829,884 (GRCm39) A590V probably damaging Het
Slfn8 G T 11: 82,908,532 (GRCm39) H4N probably benign Het
Smad9 T A 3: 54,696,756 (GRCm39) F274I possibly damaging Het
Snx4 A G 16: 33,106,380 (GRCm39) E271G probably benign Het
Spata31h1 A G 10: 82,122,573 (GRCm39) V3479A probably benign Het
Tektip1 C A 10: 81,201,611 (GRCm39) V4L probably benign Het
Thap4 G A 1: 93,678,028 (GRCm39) R253* probably null Het
Tmem65 T A 15: 58,662,028 (GRCm39) I144F Het
Tnrc6a G A 7: 122,778,958 (GRCm39) R1223Q probably benign Het
Traf7 CA CAA 17: 24,746,737 (GRCm39) probably benign Het
Trpm2 T C 10: 77,747,226 (GRCm39) Y1424C possibly damaging Het
Trrap T A 5: 144,763,478 (GRCm39) Y2457N probably damaging Het
Vmn1r7 A G 6: 57,001,508 (GRCm39) S251P probably damaging Het
Vmn2r89 A T 14: 51,693,469 (GRCm39) E273V probably damaging Het
Vps52 A G 17: 34,181,156 (GRCm39) D466G probably damaging Het
Xirp2 T C 2: 67,345,976 (GRCm39) V2739A probably benign Het
Zc3h4 C T 7: 16,168,675 (GRCm39) S1003F unknown Het
Zyg11a A T 4: 108,075,102 (GRCm39) H6Q probably damaging Het
Other mutations in Col5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Col5a2 APN 1 45,432,037 (GRCm39) splice site probably benign
IGL00978:Col5a2 APN 1 45,415,899 (GRCm39) missense probably benign 0.01
IGL01366:Col5a2 APN 1 45,431,048 (GRCm39) missense possibly damaging 0.46
IGL01487:Col5a2 APN 1 45,415,899 (GRCm39) missense probably benign 0.01
IGL01820:Col5a2 APN 1 45,481,985 (GRCm39) missense unknown
IGL01980:Col5a2 APN 1 45,421,393 (GRCm39) splice site probably benign
IGL02063:Col5a2 APN 1 45,442,579 (GRCm39) critical splice donor site probably null
IGL02134:Col5a2 APN 1 45,430,230 (GRCm39) splice site probably null
IGL02233:Col5a2 APN 1 45,422,747 (GRCm39) splice site probably null
IGL02489:Col5a2 APN 1 45,431,971 (GRCm39) splice site probably null
IGL02928:Col5a2 APN 1 45,424,180 (GRCm39) missense probably benign 0.41
IGL02931:Col5a2 APN 1 45,424,225 (GRCm39) missense probably damaging 1.00
IGL03328:Col5a2 APN 1 45,415,306 (GRCm39) missense possibly damaging 0.94
Beatnik UTSW 1 45,415,938 (GRCm39) missense probably damaging 0.99
R0022:Col5a2 UTSW 1 45,422,843 (GRCm39) nonsense probably null
R0123:Col5a2 UTSW 1 45,446,195 (GRCm39) missense probably benign 0.28
R0180:Col5a2 UTSW 1 45,450,620 (GRCm39) missense probably damaging 1.00
R0225:Col5a2 UTSW 1 45,446,195 (GRCm39) missense probably benign 0.28
R0455:Col5a2 UTSW 1 45,421,262 (GRCm39) splice site probably benign
R0485:Col5a2 UTSW 1 45,417,642 (GRCm39) missense probably damaging 0.99
R0702:Col5a2 UTSW 1 45,419,291 (GRCm39) missense possibly damaging 0.54
R0745:Col5a2 UTSW 1 45,446,387 (GRCm39) splice site probably null
R1147:Col5a2 UTSW 1 45,415,931 (GRCm39) missense probably damaging 0.99
R1147:Col5a2 UTSW 1 45,415,931 (GRCm39) missense probably damaging 0.99
R1394:Col5a2 UTSW 1 45,442,579 (GRCm39) critical splice donor site probably null
R1494:Col5a2 UTSW 1 45,542,074 (GRCm39) start codon destroyed unknown
R1499:Col5a2 UTSW 1 45,450,626 (GRCm39) missense probably benign 0.00
R1733:Col5a2 UTSW 1 45,446,192 (GRCm39) missense possibly damaging 0.81
R1789:Col5a2 UTSW 1 45,433,936 (GRCm39) missense probably damaging 0.98
R1789:Col5a2 UTSW 1 45,417,465 (GRCm39) critical splice donor site probably null
R2114:Col5a2 UTSW 1 45,415,964 (GRCm39) missense probably damaging 0.98
R2915:Col5a2 UTSW 1 45,452,656 (GRCm39) missense probably damaging 1.00
R3861:Col5a2 UTSW 1 45,419,397 (GRCm39) missense probably damaging 0.98
R4015:Col5a2 UTSW 1 45,442,631 (GRCm39) missense probably benign 0.14
R4944:Col5a2 UTSW 1 45,415,855 (GRCm39) missense possibly damaging 0.75
R4982:Col5a2 UTSW 1 45,428,618 (GRCm39) missense possibly damaging 0.88
R5001:Col5a2 UTSW 1 45,542,058 (GRCm39) missense unknown
R5159:Col5a2 UTSW 1 45,425,991 (GRCm39) critical splice donor site probably null
R5197:Col5a2 UTSW 1 45,432,241 (GRCm39) missense probably benign 0.01
R5407:Col5a2 UTSW 1 45,445,440 (GRCm39) missense possibly damaging 0.54
R5502:Col5a2 UTSW 1 45,419,286 (GRCm39) missense probably damaging 1.00
R5575:Col5a2 UTSW 1 45,417,642 (GRCm39) missense probably damaging 0.99
R5622:Col5a2 UTSW 1 45,466,219 (GRCm39) missense probably benign
R5643:Col5a2 UTSW 1 45,429,202 (GRCm39) missense probably damaging 1.00
R5801:Col5a2 UTSW 1 45,428,641 (GRCm39) critical splice acceptor site probably null
R6075:Col5a2 UTSW 1 45,542,008 (GRCm39) missense unknown
R6211:Col5a2 UTSW 1 45,415,826 (GRCm39) missense probably damaging 0.99
R6407:Col5a2 UTSW 1 45,415,938 (GRCm39) missense probably damaging 0.99
R6494:Col5a2 UTSW 1 45,417,487 (GRCm39) missense probably damaging 0.99
R6582:Col5a2 UTSW 1 45,429,275 (GRCm39) missense possibly damaging 0.91
R6687:Col5a2 UTSW 1 45,422,764 (GRCm39) missense probably damaging 1.00
R7007:Col5a2 UTSW 1 45,417,609 (GRCm39) missense possibly damaging 0.53
R7062:Col5a2 UTSW 1 45,456,785 (GRCm39) missense probably benign 0.00
R7098:Col5a2 UTSW 1 45,419,227 (GRCm39) missense possibly damaging 0.48
R7243:Col5a2 UTSW 1 45,415,320 (GRCm39) missense probably benign 0.39
R7326:Col5a2 UTSW 1 45,482,027 (GRCm39) missense unknown
R7332:Col5a2 UTSW 1 45,419,325 (GRCm39) missense probably damaging 1.00
R7642:Col5a2 UTSW 1 45,415,248 (GRCm39) missense probably benign 0.01
R7890:Col5a2 UTSW 1 45,444,147 (GRCm39) splice site probably null
R8066:Col5a2 UTSW 1 45,452,628 (GRCm39) critical splice donor site probably null
R8375:Col5a2 UTSW 1 45,481,890 (GRCm39) missense unknown
R8444:Col5a2 UTSW 1 45,435,305 (GRCm39) missense probably benign 0.06
R8506:Col5a2 UTSW 1 45,481,944 (GRCm39) missense unknown
R8686:Col5a2 UTSW 1 45,461,147 (GRCm39) missense probably damaging 1.00
R8907:Col5a2 UTSW 1 45,456,106 (GRCm39) missense probably benign 0.27
R8932:Col5a2 UTSW 1 45,419,306 (GRCm39) missense probably benign 0.00
R8933:Col5a2 UTSW 1 45,461,123 (GRCm39) missense
R9087:Col5a2 UTSW 1 45,481,818 (GRCm39) missense unknown
R9105:Col5a2 UTSW 1 45,419,366 (GRCm39) missense probably benign 0.00
R9282:Col5a2 UTSW 1 45,478,029 (GRCm39) critical splice donor site probably null
R9457:Col5a2 UTSW 1 45,431,973 (GRCm39) critical splice donor site probably null
R9568:Col5a2 UTSW 1 45,430,998 (GRCm39) missense possibly damaging 0.89
R9727:Col5a2 UTSW 1 45,415,818 (GRCm39) missense possibly damaging 0.50
X0013:Col5a2 UTSW 1 45,442,418 (GRCm39) critical splice donor site probably null
Z1176:Col5a2 UTSW 1 45,435,644 (GRCm39) missense probably benign 0.11
Z1176:Col5a2 UTSW 1 45,422,840 (GRCm39) missense probably damaging 1.00
Z1176:Col5a2 UTSW 1 45,415,306 (GRCm39) missense possibly damaging 0.94
Z1177:Col5a2 UTSW 1 45,442,633 (GRCm39) missense probably damaging 1.00
Z1177:Col5a2 UTSW 1 45,441,273 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGCTTCTATGTTACACCAAATA -3'
(R):5'- AAAGAGATTGGAGTGTTGACTGTTA -3'

Sequencing Primer
(F):5'- TCATACTTTGTCATGCATTCAGAC -3'
(R):5'- TTTCTGGTCAACTGGCTG -3'
Posted On 2022-06-15