Mutagenetix > Incidental Mutation

Incidental Mutation 'R9457:Col5a2'

714616

Institutional Source

Beutler Lab

Gene Symbol

Col5a2

Ensembl Gene

ENSMUSG00000026042

Gene Name

collagen, type V, alpha 2

Synonyms

1110014L14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9457 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45374321-45503282 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 45392813 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000083620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086430]

AlphaFold

Q3U962

Predicted Effect

probably null
Transcript: ENSMUST00000086430

SMART Domains

Protein: ENSMUSP00000083620
Gene: ENSMUSG00000026042

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
VWC	40	95	9.94e-23	SMART
Pfam:Collagen	123	186	1.5e-10	PFAM
Pfam:Collagen	207	272	2.9e-9	PFAM
low complexity region	319	347	N/A	INTRINSIC
internal_repeat_1	349	421	3.18e-18	PROSPERO
internal_repeat_2	385	422	1.34e-12	PROSPERO
internal_repeat_5	388	423	1.55e-7	PROSPERO
low complexity region	424	460	N/A	INTRINSIC
low complexity region	471	508	N/A	INTRINSIC
internal_repeat_6	509	535	5.68e-7	PROSPERO
internal_repeat_2	511	548	1.34e-12	PROSPERO
internal_repeat_3	520	549	1.16e-11	PROSPERO
internal_repeat_1	520	571	3.18e-18	PROSPERO
internal_repeat_4	546	574	4.91e-9	PROSPERO
low complexity region	595	611	N/A	INTRINSIC
internal_repeat_7	616	741	1.35e-6	PROSPERO
low complexity region	742	757	N/A	INTRINSIC
Pfam:Collagen	790	870	4.8e-8	PFAM
low complexity region	877	898	N/A	INTRINSIC
Pfam:Collagen	907	979	4.2e-8	PFAM
internal_repeat_4	993	1021	4.91e-9	PROSPERO
internal_repeat_3	994	1023	1.16e-11	PROSPERO
low complexity region	1024	1054	N/A	INTRINSIC
internal_repeat_6	1055	1078	5.68e-7	PROSPERO
low complexity region	1081	1096	N/A	INTRINSIC
Pfam:Collagen	1111	1171	9.7e-12	PFAM
Pfam:Collagen	1168	1230	1.4e-9	PFAM
COLFI	1263	1497	1.83e-164	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-2 subunit of type V collagen, one of the low abundance fibrillar collagens that gets incorporated into growing fibrils with type I collagen. The encoded protein, in association with alpha-1 and/or alpha-3 subunits, forms homo- or heterotrimeric type V procollagen that undergoes proteolytic processing. Mice lacking the encoded protein die in utero. Transgenic mice that produce a structurally abnormal form of the encoded protein survive poorly and exhibit skin fragility, skeletal abnormalities and alterations in the collagen fiber organization. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals exhibit reduced body weight, reduced bone growth rate, thin, fragile skin, variable degrees of lordosis and kyphosis, abnormal localization of hair follicles in the dermis, and thinned stroma of the cornea. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	A	G	18: 12,179,246	H181R	probably benign	Het
4930404N11Rik	C	A	10: 81,365,777	V4L	probably benign	Het
4930430A15Rik	A	T	2: 111,170,286	M196K	unknown	Het
4932415D10Rik	A	G	10: 82,286,739	V3479A	probably benign	Het
A930009A15Rik	T	C	10: 115,578,331	L54P	unknown	Het
Ablim3	A	G	18: 61,845,849	S204P	probably benign	Het
Acadl	A	G	1: 66,853,241	V141A	probably benign	Het
Ace3	A	G	11: 105,994,861	D31G	probably benign	Het
Adam11	T	G	11: 102,769,898	V85G	probably benign	Het
Adarb1	A	T	10: 77,322,148	M155K	possibly damaging	Het
Arhgap10	G	A	8: 77,384,786	T376M	probably benign	Het
Bod1l	G	T	5: 41,821,967	T668K	probably damaging	Het
Ccdc87	A	G	19: 4,841,631	E717G	probably damaging	Het
Cdh17	T	A	4: 11,771,329	I37N	probably damaging	Het
Cfap99	T	G	5: 34,301,397	F45L	probably benign	Het
Chsy1	C	A	7: 66,172,400	H794Q	probably benign	Het
Clec4a3	G	A	6: 122,954,086	V45I	probably benign	Het
Clic3	G	A	2: 25,457,718	V32I	probably benign	Het
Clip2	A	T	5: 134,502,730	D740E	probably benign	Het
Cyp2j11	C	T	4: 96,307,359	V367I	probably damaging	Het
Ddr1	C	T	17: 35,682,758	A821T	possibly damaging	Het
Dna2	G	A	10: 62,950,793	E107K	probably benign	Het
Eif3d	A	G	15: 77,959,694	V484A	probably benign	Het
Fgfr4	A	G	13: 55,161,127	T354A	probably benign	Het
Fkbp6	T	C	5: 135,349,632	D54G	probably benign	Het
Gm4787	T	A	12: 81,379,246	E46V	probably damaging	Het
Gm47995	A	G	1: 151,198,475	T10A	possibly damaging	Het
Gm498	T	C	7: 143,883,976	V137A	possibly damaging	Het
Gnb1l	T	A	16: 18,540,995	I50N	probably damaging	Het
Gphb5	A	T	12: 75,415,749	V22D	probably damaging	Het
Gstt4	C	T	10: 75,815,125	C221Y	probably benign	Het
Hmces	T	C	6: 87,933,274	V222A	possibly damaging	Het
Kat14	T	A	2: 144,373,782	D62E	probably benign	Het
Kcnmb2	T	A	3: 32,181,869	V89E	probably benign	Het
Kif23	T	A	9: 61,944,225	N63I	probably benign	Het
Lamc2	T	C	1: 153,139,854	M578V	probably benign	Het
Ltbp2	A	T	12: 84,789,153	C1335S	probably benign	Het
Lyst	A	G	13: 13,687,745	E2622G	possibly damaging	Het
Mctp1	A	T	13: 76,384,674	H47L	probably benign	Het
Micalcl	A	G	7: 112,411,458	K618R	probably damaging	Het
Mllt6	T	C	11: 97,665,760	I92T	probably benign	Het
Morc2a	A	G	11: 3,676,184	I223V	probably benign	Het
Msh3	A	T	13: 92,345,086	I306N	probably benign	Het
Myo3b	T	A	2: 70,095,209	S35T	probably benign	Het
Nfkbiz	A	T	16: 55,813,984	V700E	probably damaging	Het
Oit3	T	A	10: 59,441,683	M1L	unknown	Het
Olfr1048	A	T	2: 86,236,472	I114K	probably damaging	Het
Olfr1231	A	T	2: 89,302,731	I287N	probably damaging	Het
Olfr606	T	A	7: 103,451,411	F25I	probably benign	Het
Peg3	T	G	7: 6,707,999	D1408A	probably damaging	Het
Plaa	A	C	4: 94,586,883	S201R	possibly damaging	Het
Psmd5	A	G	2: 34,854,326	S395P	probably benign	Het
Ralgapa2	T	C	2: 146,334,554	I1701V	probably damaging	Het
Rnf32	G	A	5: 29,206,186	A157T	probably damaging	Het
Rrad	T	A	8: 104,629,727		probably null	Het
Samm50	T	A	15: 84,207,841	L339Q	probably damaging	Het
Scin	T	C	12: 40,104,958	E212G	possibly damaging	Het
Scrib	T	C	15: 76,067,299	D146G	probably damaging	Het
Slc19a1	G	A	10: 77,049,771	D502N	probably benign	Het
Slc4a4	T	C	5: 89,214,573	S839P	probably damaging	Het
Slc4a8	A	G	15: 100,806,260	D764G	probably damaging	Het
Slc6a19	G	A	13: 73,681,765	A590V	probably damaging	Het
Slfn8	G	T	11: 83,017,706	H4N	probably benign	Het
Smad9	T	A	3: 54,789,335	F274I	possibly damaging	Het
Snx4	A	G	16: 33,286,010	E271G	probably benign	Het
Thap4	G	A	1: 93,750,306	R253*	probably null	Het
Tmem65	T	A	15: 58,790,179	I144F		Het
Tnrc6a	G	A	7: 123,179,735	R1223Q	probably benign	Het
Traf7	CA	CAA	17: 24,527,763		probably benign	Het
Trpm2	T	C	10: 77,911,392	Y1424C	possibly damaging	Het
Trrap	T	A	5: 144,826,668	Y2457N	probably damaging	Het
Vmn1r7	A	G	6: 57,024,523	S251P	probably damaging	Het
Vmn2r89	A	T	14: 51,456,012	E273V	probably damaging	Het
Vps52	A	G	17: 33,962,182	D466G	probably damaging	Het
Xirp2	T	C	2: 67,515,632	V2739A	probably benign	Het
Zc3h4	C	T	7: 16,434,750	S1003F	unknown	Het
Zyg11a	A	T	4: 108,217,905	H6Q	probably damaging	Het

Other mutations in Col5a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Col5a2	APN	1	45392877	splice site	probably benign
IGL00978:Col5a2	APN	1	45376739	missense	probably benign	0.01
IGL01366:Col5a2	APN	1	45391888	missense	possibly damaging	0.46
IGL01487:Col5a2	APN	1	45376739	missense	probably benign	0.01
IGL01820:Col5a2	APN	1	45442825	missense	unknown
IGL01980:Col5a2	APN	1	45382233	splice site	probably benign
IGL02063:Col5a2	APN	1	45403419	critical splice donor site	probably null
IGL02134:Col5a2	APN	1	45391070	splice site	probably null
IGL02233:Col5a2	APN	1	45383587	splice site	probably null
IGL02489:Col5a2	APN	1	45392811	splice site	probably null
IGL02928:Col5a2	APN	1	45385020	missense	probably benign	0.41
IGL02931:Col5a2	APN	1	45385065	missense	probably damaging	1.00
IGL03328:Col5a2	APN	1	45376146	missense	possibly damaging	0.94
Beatnik	UTSW	1	45376778	missense	probably damaging	0.99
R0022:Col5a2	UTSW	1	45383683	nonsense	probably null
R0123:Col5a2	UTSW	1	45407035	missense	probably benign	0.28
R0180:Col5a2	UTSW	1	45411460	missense	probably damaging	1.00
R0225:Col5a2	UTSW	1	45407035	missense	probably benign	0.28
R0455:Col5a2	UTSW	1	45382102	splice site	probably benign
R0485:Col5a2	UTSW	1	45378482	missense	probably damaging	0.99
R0702:Col5a2	UTSW	1	45380131	missense	possibly damaging	0.54
R0745:Col5a2	UTSW	1	45407227	splice site	probably null
R1147:Col5a2	UTSW	1	45376771	missense	probably damaging	0.99
R1147:Col5a2	UTSW	1	45376771	missense	probably damaging	0.99
R1394:Col5a2	UTSW	1	45403419	critical splice donor site	probably null
R1494:Col5a2	UTSW	1	45502914	start codon destroyed	unknown
R1499:Col5a2	UTSW	1	45411466	missense	probably benign	0.00
R1733:Col5a2	UTSW	1	45407032	missense	possibly damaging	0.81
R1789:Col5a2	UTSW	1	45378305	critical splice donor site	probably null
R1789:Col5a2	UTSW	1	45394776	missense	probably damaging	0.98
R2114:Col5a2	UTSW	1	45376804	missense	probably damaging	0.98
R2915:Col5a2	UTSW	1	45413496	missense	probably damaging	1.00
R3861:Col5a2	UTSW	1	45380237	missense	probably damaging	0.98
R4015:Col5a2	UTSW	1	45403471	missense	probably benign	0.14
R4944:Col5a2	UTSW	1	45376695	missense	possibly damaging	0.75
R4982:Col5a2	UTSW	1	45389458	missense	possibly damaging	0.88
R5001:Col5a2	UTSW	1	45502898	missense	unknown
R5159:Col5a2	UTSW	1	45386831	critical splice donor site	probably null
R5197:Col5a2	UTSW	1	45393081	missense	probably benign	0.01
R5407:Col5a2	UTSW	1	45406280	missense	possibly damaging	0.54
R5502:Col5a2	UTSW	1	45380126	missense	probably damaging	1.00
R5575:Col5a2	UTSW	1	45378482	missense	probably damaging	0.99
R5622:Col5a2	UTSW	1	45427059	missense	probably benign
R5643:Col5a2	UTSW	1	45390042	missense	probably damaging	1.00
R5801:Col5a2	UTSW	1	45389481	critical splice acceptor site	probably null
R6075:Col5a2	UTSW	1	45502848	missense	unknown
R6211:Col5a2	UTSW	1	45376666	missense	probably damaging	0.99
R6407:Col5a2	UTSW	1	45376778	missense	probably damaging	0.99
R6494:Col5a2	UTSW	1	45378327	missense	probably damaging	0.99
R6582:Col5a2	UTSW	1	45390115	missense	possibly damaging	0.91
R6687:Col5a2	UTSW	1	45383604	missense	probably damaging	1.00
R7007:Col5a2	UTSW	1	45378449	missense	possibly damaging	0.53
R7062:Col5a2	UTSW	1	45417625	missense	probably benign	0.00
R7098:Col5a2	UTSW	1	45380067	missense	possibly damaging	0.48
R7243:Col5a2	UTSW	1	45376160	missense	probably benign	0.39
R7326:Col5a2	UTSW	1	45442867	missense	unknown
R7332:Col5a2	UTSW	1	45380165	missense	probably damaging	1.00
R7642:Col5a2	UTSW	1	45376088	missense	probably benign	0.01
R7890:Col5a2	UTSW	1	45404987	splice site	probably null
R8066:Col5a2	UTSW	1	45413468	critical splice donor site	probably null
R8375:Col5a2	UTSW	1	45442730	missense	unknown
R8444:Col5a2	UTSW	1	45396145	missense	probably benign	0.06
R8506:Col5a2	UTSW	1	45442784	missense	unknown
R8686:Col5a2	UTSW	1	45421987	missense	probably damaging	1.00
R8907:Col5a2	UTSW	1	45416946	missense	probably benign	0.27
R8932:Col5a2	UTSW	1	45380146	missense	probably benign	0.00
R8933:Col5a2	UTSW	1	45421963	missense
R9087:Col5a2	UTSW	1	45442658	missense	unknown
R9105:Col5a2	UTSW	1	45380206	missense	probably benign	0.00
R9282:Col5a2	UTSW	1	45438869	critical splice donor site	probably null
R9457:Col5a2	UTSW	1	45386844	missense	probably benign	0.00
R9568:Col5a2	UTSW	1	45391838	missense	possibly damaging	0.89
R9727:Col5a2	UTSW	1	45376658	missense	possibly damaging	0.50
X0013:Col5a2	UTSW	1	45403258	critical splice donor site	probably null
Z1176:Col5a2	UTSW	1	45376146	missense	possibly damaging	0.94
Z1176:Col5a2	UTSW	1	45383680	missense	probably damaging	1.00
Z1176:Col5a2	UTSW	1	45396484	missense	probably benign	0.11
Z1177:Col5a2	UTSW	1	45402113	missense	probably damaging	1.00
Z1177:Col5a2	UTSW	1	45403473	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGACACTAGAGTTTAGACAGACAG -3'
(R):5'- TCAAGACTGTGGTTGAGGTAGAC -3'

Sequencing Primer
(F):5'- CAGACAGTGATTAATGATTGGTAGG -3'
(R):5'- AGGTAGACCATTTTAGAGCTTGCCTC -3'

Posted On

2022-06-15