Incidental Mutation 'R9457:Clic3'
ID 714621
Institutional Source Beutler Lab
Gene Symbol Clic3
Ensembl Gene ENSMUSG00000015093
Gene Name chloride intracellular channel 3
Synonyms 2300003G24Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 25346855-25348789 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 25347730 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 32 (V32I)
Ref Sequence ENSEMBL: ENSMUSP00000109904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102918] [ENSMUST00000114261] [ENSMUST00000114265] [ENSMUST00000151239]
AlphaFold Q9D7P7
Predicted Effect probably benign
Transcript: ENSMUST00000102918
AA Change: V30I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099982
Gene: ENSMUSG00000015093
AA Change: V30I

DomainStartEndE-ValueType
Pfam:GST_N_3 17 89 9.8e-11 PFAM
Pfam:GST_N_2 20 84 1.6e-8 PFAM
Pfam:GST_C_2 77 207 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114261
SMART Domains Protein: ENSMUSP00000109899
Gene: ENSMUSG00000047617

DomainStartEndE-ValueType
Pfam:PAXX 10 205 5.7e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114265
AA Change: V32I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109904
Gene: ENSMUSG00000015093
AA Change: V32I

DomainStartEndE-ValueType
Pfam:GST_N_3 19 91 2e-11 PFAM
Pfam:GST_N_2 22 86 3.6e-9 PFAM
Pfam:GST_C_2 80 209 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151239
SMART Domains Protein: ENSMUSP00000120533
Gene: ENSMUSG00000047617

DomainStartEndE-ValueType
Pfam:DUF4610 8 156 2.2e-64 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 3 is a member of the p64 family and is predominantly localized in the nucleus and stimulates chloride ion channel activity. In addition, this protein may participate in cellular growth control, based on its association with ERK7, a member of the MAP kinase family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik T C 10: 115,414,236 (GRCm39) L54P unknown Het
Ablim3 A G 18: 61,978,920 (GRCm39) S204P probably benign Het
Acadl A G 1: 66,892,400 (GRCm39) V141A probably benign Het
Ace3 A G 11: 105,885,687 (GRCm39) D31G probably benign Het
Acte1 T C 7: 143,437,713 (GRCm39) V137A possibly damaging Het
Adam11 T G 11: 102,660,724 (GRCm39) V85G probably benign Het
Adarb1 A T 10: 77,157,982 (GRCm39) M155K possibly damaging Het
Arhgap10 G A 8: 78,111,415 (GRCm39) T376M probably benign Het
Bod1l G T 5: 41,979,310 (GRCm39) T668K probably damaging Het
Ccdc87 A G 19: 4,891,659 (GRCm39) E717G probably damaging Het
Cdh17 T A 4: 11,771,329 (GRCm39) I37N probably damaging Het
Cfap99 T G 5: 34,458,741 (GRCm39) F45L probably benign Het
Chsy1 C A 7: 65,822,148 (GRCm39) H794Q probably benign Het
Clec4a3 G A 6: 122,931,045 (GRCm39) V45I probably benign Het
Clip2 A T 5: 134,531,584 (GRCm39) D740E probably benign Het
Col5a2 C T 1: 45,426,004 (GRCm39) V1062I probably benign Het
Col5a2 A G 1: 45,431,973 (GRCm39) probably null Het
Cyp2j11 C T 4: 96,195,596 (GRCm39) V367I probably damaging Het
Ddr1 C T 17: 35,993,650 (GRCm39) A821T possibly damaging Het
Dna2 G A 10: 62,786,572 (GRCm39) E107K probably benign Het
Eif3d A G 15: 77,843,894 (GRCm39) V484A probably benign Het
Fgfr4 A G 13: 55,308,940 (GRCm39) T354A probably benign Het
Fkbp6 T C 5: 135,378,486 (GRCm39) D54G probably benign Het
Gm4787 T A 12: 81,426,020 (GRCm39) E46V probably damaging Het
Gm47995 A G 1: 151,074,226 (GRCm39) T10A possibly damaging Het
Gnb1l T A 16: 18,359,745 (GRCm39) I50N probably damaging Het
Gphb5 A T 12: 75,462,523 (GRCm39) V22D probably damaging Het
Gstt4 C T 10: 75,650,959 (GRCm39) C221Y probably benign Het
Hmces T C 6: 87,910,256 (GRCm39) V222A possibly damaging Het
Kat14 T A 2: 144,215,702 (GRCm39) D62E probably benign Het
Kcnmb2 T A 3: 32,236,018 (GRCm39) V89E probably benign Het
Kif23 T A 9: 61,851,507 (GRCm39) N63I probably benign Het
Lamc2 T C 1: 153,015,600 (GRCm39) M578V probably benign Het
Ltbp2 A T 12: 84,835,927 (GRCm39) C1335S probably benign Het
Lyst A G 13: 13,862,330 (GRCm39) E2622G possibly damaging Het
Mctp1 A T 13: 76,532,793 (GRCm39) H47L probably benign Het
Mical2 A G 7: 112,010,665 (GRCm39) K618R probably damaging Het
Mllt6 T C 11: 97,556,586 (GRCm39) I92T probably benign Het
Morc2a A G 11: 3,626,184 (GRCm39) I223V probably benign Het
Msh3 A T 13: 92,481,594 (GRCm39) I306N probably benign Het
Myo3b T A 2: 69,925,553 (GRCm39) S35T probably benign Het
Nfkbiz A T 16: 55,634,347 (GRCm39) V700E probably damaging Het
Oit3 T A 10: 59,277,505 (GRCm39) M1L unknown Het
Or4c1 A T 2: 89,133,075 (GRCm39) I287N probably damaging Het
Or51l14 T A 7: 103,100,618 (GRCm39) F25I probably benign Het
Or8k17 A T 2: 86,066,816 (GRCm39) I114K probably damaging Het
Peg3 T G 7: 6,710,998 (GRCm39) D1408A probably damaging Het
Plaa A C 4: 94,475,120 (GRCm39) S201R possibly damaging Het
Potefam1 A T 2: 111,000,631 (GRCm39) M196K unknown Het
Psmd5 A G 2: 34,744,338 (GRCm39) S395P probably benign Het
Ralgapa2 T C 2: 146,176,474 (GRCm39) I1701V probably damaging Het
Rmc1 A G 18: 12,312,303 (GRCm39) H181R probably benign Het
Rnf32 G A 5: 29,411,184 (GRCm39) A157T probably damaging Het
Rrad T A 8: 105,356,359 (GRCm39) probably null Het
Samm50 T A 15: 84,092,042 (GRCm39) L339Q probably damaging Het
Scin T C 12: 40,154,957 (GRCm39) E212G possibly damaging Het
Scrib T C 15: 75,939,148 (GRCm39) D146G probably damaging Het
Slc19a1 G A 10: 76,885,605 (GRCm39) D502N probably benign Het
Slc4a4 T C 5: 89,362,432 (GRCm39) S839P probably damaging Het
Slc4a8 A G 15: 100,704,141 (GRCm39) D764G probably damaging Het
Slc6a19 G A 13: 73,829,884 (GRCm39) A590V probably damaging Het
Slfn8 G T 11: 82,908,532 (GRCm39) H4N probably benign Het
Smad9 T A 3: 54,696,756 (GRCm39) F274I possibly damaging Het
Snx4 A G 16: 33,106,380 (GRCm39) E271G probably benign Het
Spata31h1 A G 10: 82,122,573 (GRCm39) V3479A probably benign Het
Tektip1 C A 10: 81,201,611 (GRCm39) V4L probably benign Het
Thap4 G A 1: 93,678,028 (GRCm39) R253* probably null Het
Tmem65 T A 15: 58,662,028 (GRCm39) I144F Het
Tnrc6a G A 7: 122,778,958 (GRCm39) R1223Q probably benign Het
Traf7 CA CAA 17: 24,746,737 (GRCm39) probably benign Het
Trpm2 T C 10: 77,747,226 (GRCm39) Y1424C possibly damaging Het
Trrap T A 5: 144,763,478 (GRCm39) Y2457N probably damaging Het
Vmn1r7 A G 6: 57,001,508 (GRCm39) S251P probably damaging Het
Vmn2r89 A T 14: 51,693,469 (GRCm39) E273V probably damaging Het
Vps52 A G 17: 34,181,156 (GRCm39) D466G probably damaging Het
Xirp2 T C 2: 67,345,976 (GRCm39) V2739A probably benign Het
Zc3h4 C T 7: 16,168,675 (GRCm39) S1003F unknown Het
Zyg11a A T 4: 108,075,102 (GRCm39) H6Q probably damaging Het
Other mutations in Clic3
AlleleSourceChrCoordTypePredicted EffectPPH Score
knife UTSW 2 25,347,779 (GRCm39) missense possibly damaging 0.94
R0491:Clic3 UTSW 2 25,347,797 (GRCm39) unclassified probably benign
R0533:Clic3 UTSW 2 25,348,150 (GRCm39) missense probably damaging 1.00
R4798:Clic3 UTSW 2 25,348,194 (GRCm39) missense probably damaging 1.00
R4940:Clic3 UTSW 2 25,347,929 (GRCm39) missense probably benign 0.00
R5579:Clic3 UTSW 2 25,348,319 (GRCm39) missense probably damaging 0.99
R5713:Clic3 UTSW 2 25,348,179 (GRCm39) missense probably damaging 1.00
R6669:Clic3 UTSW 2 25,347,779 (GRCm39) missense possibly damaging 0.94
R7169:Clic3 UTSW 2 25,348,731 (GRCm39) missense probably benign 0.02
R8033:Clic3 UTSW 2 25,348,617 (GRCm39) missense probably benign 0.00
R9131:Clic3 UTSW 2 25,348,325 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGTAGATGCCATGCTCAACC -3'
(R):5'- TTGACATCCCCATCGTACAGC -3'

Sequencing Primer
(F):5'- TGCTCAACCAGGCCAGAG -3'
(R):5'- TCCCCATCGTACAGCAGGATG -3'
Posted On 2022-06-15