Incidental Mutation 'R9457:Plaa'
ID 714633
Institutional Source Beutler Lab
Gene Symbol Plaa
Ensembl Gene ENSMUSG00000028577
Gene Name phospholipase A2, activating protein
Synonyms D4Ertd618e, Ufd3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 94567514-94603244 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 94586883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 201 (S201R)
Ref Sequence ENSEMBL: ENSMUSP00000102724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107107]
AlphaFold P27612
Predicted Effect possibly damaging
Transcript: ENSMUST00000107107
AA Change: S201R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102724
Gene: ENSMUSG00000028577
AA Change: S201R

DomainStartEndE-ValueType
WD40 7 47 4.46e-1 SMART
WD40 54 98 8.49e-3 SMART
WD40 101 139 1.72e-3 SMART
WD40 140 179 8.81e-10 SMART
WD40 180 218 3.22e-3 SMART
WD40 220 259 7.33e-7 SMART
WD40 260 298 6.79e-2 SMART
Pfam:PFU 345 459 2.3e-43 PFAM
Pfam:PUL 535 789 1.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127656
SMART Domains Protein: ENSMUSP00000116530
Gene: ENSMUSG00000028577

DomainStartEndE-ValueType
Pfam:PFU 1 89 2.6e-34 PFAM
Pfam:PUL 142 214 7.5e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous KO is embryonic lethal. A hypomorphic homozygous point mutation affects neuromuscular junctions and Purkinje cell development, causing early-onset neurodysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,179,246 H181R probably benign Het
4930404N11Rik C A 10: 81,365,777 V4L probably benign Het
4930430A15Rik A T 2: 111,170,286 M196K unknown Het
4932415D10Rik A G 10: 82,286,739 V3479A probably benign Het
A930009A15Rik T C 10: 115,578,331 L54P unknown Het
Ablim3 A G 18: 61,845,849 S204P probably benign Het
Acadl A G 1: 66,853,241 V141A probably benign Het
Ace3 A G 11: 105,994,861 D31G probably benign Het
Adam11 T G 11: 102,769,898 V85G probably benign Het
Adarb1 A T 10: 77,322,148 M155K possibly damaging Het
Arhgap10 G A 8: 77,384,786 T376M probably benign Het
Bod1l G T 5: 41,821,967 T668K probably damaging Het
Ccdc87 A G 19: 4,841,631 E717G probably damaging Het
Cdh17 T A 4: 11,771,329 I37N probably damaging Het
Cfap99 T G 5: 34,301,397 F45L probably benign Het
Chsy1 C A 7: 66,172,400 H794Q probably benign Het
Clec4a3 G A 6: 122,954,086 V45I probably benign Het
Clic3 G A 2: 25,457,718 V32I probably benign Het
Clip2 A T 5: 134,502,730 D740E probably benign Het
Col5a2 C T 1: 45,386,844 V1062I probably benign Het
Col5a2 A G 1: 45,392,813 probably null Het
Cyp2j11 C T 4: 96,307,359 V367I probably damaging Het
Ddr1 C T 17: 35,682,758 A821T possibly damaging Het
Dna2 G A 10: 62,950,793 E107K probably benign Het
Eif3d A G 15: 77,959,694 V484A probably benign Het
Fgfr4 A G 13: 55,161,127 T354A probably benign Het
Fkbp6 T C 5: 135,349,632 D54G probably benign Het
Gm4787 T A 12: 81,379,246 E46V probably damaging Het
Gm47995 A G 1: 151,198,475 T10A possibly damaging Het
Gm498 T C 7: 143,883,976 V137A possibly damaging Het
Gnb1l T A 16: 18,540,995 I50N probably damaging Het
Gphb5 A T 12: 75,415,749 V22D probably damaging Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Hmces T C 6: 87,933,274 V222A possibly damaging Het
Kat14 T A 2: 144,373,782 D62E probably benign Het
Kcnmb2 T A 3: 32,181,869 V89E probably benign Het
Kif23 T A 9: 61,944,225 N63I probably benign Het
Lamc2 T C 1: 153,139,854 M578V probably benign Het
Ltbp2 A T 12: 84,789,153 C1335S probably benign Het
Lyst A G 13: 13,687,745 E2622G possibly damaging Het
Mctp1 A T 13: 76,384,674 H47L probably benign Het
Micalcl A G 7: 112,411,458 K618R probably damaging Het
Mllt6 T C 11: 97,665,760 I92T probably benign Het
Morc2a A G 11: 3,676,184 I223V probably benign Het
Msh3 A T 13: 92,345,086 I306N probably benign Het
Myo3b T A 2: 70,095,209 S35T probably benign Het
Nfkbiz A T 16: 55,813,984 V700E probably damaging Het
Oit3 T A 10: 59,441,683 M1L unknown Het
Olfr1048 A T 2: 86,236,472 I114K probably damaging Het
Olfr1231 A T 2: 89,302,731 I287N probably damaging Het
Olfr606 T A 7: 103,451,411 F25I probably benign Het
Peg3 T G 7: 6,707,999 D1408A probably damaging Het
Psmd5 A G 2: 34,854,326 S395P probably benign Het
Ralgapa2 T C 2: 146,334,554 I1701V probably damaging Het
Rnf32 G A 5: 29,206,186 A157T probably damaging Het
Rrad T A 8: 104,629,727 probably null Het
Samm50 T A 15: 84,207,841 L339Q probably damaging Het
Scin T C 12: 40,104,958 E212G possibly damaging Het
Scrib T C 15: 76,067,299 D146G probably damaging Het
Slc19a1 G A 10: 77,049,771 D502N probably benign Het
Slc4a4 T C 5: 89,214,573 S839P probably damaging Het
Slc4a8 A G 15: 100,806,260 D764G probably damaging Het
Slc6a19 G A 13: 73,681,765 A590V probably damaging Het
Slfn8 G T 11: 83,017,706 H4N probably benign Het
Smad9 T A 3: 54,789,335 F274I possibly damaging Het
Snx4 A G 16: 33,286,010 E271G probably benign Het
Thap4 G A 1: 93,750,306 R253* probably null Het
Tmem65 T A 15: 58,790,179 I144F Het
Tnrc6a G A 7: 123,179,735 R1223Q probably benign Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Trpm2 T C 10: 77,911,392 Y1424C possibly damaging Het
Trrap T A 5: 144,826,668 Y2457N probably damaging Het
Vmn1r7 A G 6: 57,024,523 S251P probably damaging Het
Vmn2r89 A T 14: 51,456,012 E273V probably damaging Het
Vps52 A G 17: 33,962,182 D466G probably damaging Het
Xirp2 T C 2: 67,515,632 V2739A probably benign Het
Zc3h4 C T 7: 16,434,750 S1003F unknown Het
Zyg11a A T 4: 108,217,905 H6Q probably damaging Het
Other mutations in Plaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Plaa APN 4 94582607 missense probably benign 0.00
IGL01089:Plaa APN 4 94574047 missense probably benign
IGL01695:Plaa APN 4 94574037 nonsense probably null
IGL01984:Plaa APN 4 94571685 splice site probably null
IGL02430:Plaa APN 4 94582573 missense probably benign 0.09
IGL02552:Plaa APN 4 94582480 critical splice donor site probably null
IGL03238:Plaa APN 4 94583896 missense probably benign 0.23
R1353:Plaa UTSW 4 94571689 missense possibly damaging 0.69
R2937:Plaa UTSW 4 94569459 missense probably damaging 1.00
R3076:Plaa UTSW 4 94569805 missense probably benign
R3078:Plaa UTSW 4 94569805 missense probably benign
R3801:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3802:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3804:Plaa UTSW 4 94569888 missense probably damaging 1.00
R3836:Plaa UTSW 4 94586922 critical splice acceptor site probably null
R4767:Plaa UTSW 4 94586258 unclassified probably benign
R4855:Plaa UTSW 4 94586408 missense probably damaging 1.00
R4978:Plaa UTSW 4 94589932 missense possibly damaging 0.81
R5284:Plaa UTSW 4 94569637 missense probably benign 0.03
R5557:Plaa UTSW 4 94584007 splice site probably null
R5834:Plaa UTSW 4 94583469 missense probably damaging 1.00
R5856:Plaa UTSW 4 94583487 missense probably benign 0.00
R6053:Plaa UTSW 4 94589884 missense probably benign 0.00
R6145:Plaa UTSW 4 94583992 missense probably damaging 0.99
R6646:Plaa UTSW 4 94589978 missense probably benign
R7008:Plaa UTSW 4 94569349 makesense probably null
R7058:Plaa UTSW 4 94569823 nonsense probably null
R7078:Plaa UTSW 4 94574051 missense probably benign
R7120:Plaa UTSW 4 94582682 missense possibly damaging 0.91
R7651:Plaa UTSW 4 94582639 missense probably damaging 1.00
R8163:Plaa UTSW 4 94569403 missense probably benign 0.01
R8188:Plaa UTSW 4 94586349 missense probably damaging 1.00
R8354:Plaa UTSW 4 94569477 missense probably damaging 1.00
R8454:Plaa UTSW 4 94569477 missense probably damaging 1.00
R8838:Plaa UTSW 4 94583554 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGTCTTTCTTCAATCACTCAAGAGC -3'
(R):5'- GTTACCACACCACTTTCTACAGG -3'

Sequencing Primer
(F):5'- CCTTTGGAGTTTGGAAAGAC -3'
(R):5'- CAGTCAACCAAGTGGTAC -3'
Posted On 2022-06-15