Incidental Mutation 'R9457:Rnf32'
ID 714636
Institutional Source Beutler Lab
Gene Symbol Rnf32
Ensembl Gene ENSMUSG00000029130
Gene Name ring finger protein 32
Synonyms 2700025B22Rik, 1700009J01Rik, Lmbr2, 4930542N22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 29195992-29228457 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 29206186 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 157 (A157T)
Ref Sequence ENSEMBL: ENSMUSP00000001247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001247] [ENSMUST00000160246] [ENSMUST00000160383] [ENSMUST00000160888] [ENSMUST00000161398] [ENSMUST00000168460] [ENSMUST00000198669]
AlphaFold Q9JIT1
Predicted Effect probably damaging
Transcript: ENSMUST00000001247
AA Change: A157T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001247
Gene: ENSMUSG00000029130
AA Change: A157T

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 97 107 N/A INTRINSIC
RING 129 170 4.8e-7 SMART
IQ 187 209 1.23e-1 SMART
RING 295 357 3.84e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160246
AA Change: A157T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124657
Gene: ENSMUSG00000029130
AA Change: A157T

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 97 107 N/A INTRINSIC
RING 129 170 4.8e-7 SMART
IQ 187 209 1.23e-1 SMART
RING 295 357 3.84e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160383
SMART Domains Protein: ENSMUSP00000125515
Gene: ENSMUSG00000029130

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160888
SMART Domains Protein: ENSMUSP00000124499
Gene: ENSMUSG00000029130

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 97 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161398
SMART Domains Protein: ENSMUSP00000125741
Gene: ENSMUSG00000029130

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 24 38 N/A INTRINSIC
low complexity region 80 90 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123952
Gene: ENSMUSG00000029130
AA Change: A119T

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 60 70 N/A INTRINSIC
RING 92 133 4.8e-7 SMART
IQ 150 172 1.23e-1 SMART
RING 202 264 3.84e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168460
AA Change: A157T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132213
Gene: ENSMUSG00000029130
AA Change: A157T

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 97 107 N/A INTRINSIC
RING 129 170 4.8e-7 SMART
IQ 187 209 1.23e-1 SMART
RING 295 357 3.84e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198669
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains two RING ring finger motifs. RING finger motifs are present in a variety of functionally distinct proteins and are known to be involved in protein-DNA or protein-protein interactions. This gene was found to be expressed during spermatogenesis, most likely in spermatocytes and/or in spermatids. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,179,246 H181R probably benign Het
4930404N11Rik C A 10: 81,365,777 V4L probably benign Het
4930430A15Rik A T 2: 111,170,286 M196K unknown Het
4932415D10Rik A G 10: 82,286,739 V3479A probably benign Het
A930009A15Rik T C 10: 115,578,331 L54P unknown Het
Ablim3 A G 18: 61,845,849 S204P probably benign Het
Acadl A G 1: 66,853,241 V141A probably benign Het
Ace3 A G 11: 105,994,861 D31G probably benign Het
Adam11 T G 11: 102,769,898 V85G probably benign Het
Adarb1 A T 10: 77,322,148 M155K possibly damaging Het
Arhgap10 G A 8: 77,384,786 T376M probably benign Het
Bod1l G T 5: 41,821,967 T668K probably damaging Het
Ccdc87 A G 19: 4,841,631 E717G probably damaging Het
Cdh17 T A 4: 11,771,329 I37N probably damaging Het
Cfap99 T G 5: 34,301,397 F45L probably benign Het
Chsy1 C A 7: 66,172,400 H794Q probably benign Het
Clec4a3 G A 6: 122,954,086 V45I probably benign Het
Clic3 G A 2: 25,457,718 V32I probably benign Het
Clip2 A T 5: 134,502,730 D740E probably benign Het
Col5a2 C T 1: 45,386,844 V1062I probably benign Het
Col5a2 A G 1: 45,392,813 probably null Het
Cyp2j11 C T 4: 96,307,359 V367I probably damaging Het
Ddr1 C T 17: 35,682,758 A821T possibly damaging Het
Dna2 G A 10: 62,950,793 E107K probably benign Het
Eif3d A G 15: 77,959,694 V484A probably benign Het
Fgfr4 A G 13: 55,161,127 T354A probably benign Het
Fkbp6 T C 5: 135,349,632 D54G probably benign Het
Gm4787 T A 12: 81,379,246 E46V probably damaging Het
Gm47995 A G 1: 151,198,475 T10A possibly damaging Het
Gm498 T C 7: 143,883,976 V137A possibly damaging Het
Gnb1l T A 16: 18,540,995 I50N probably damaging Het
Gphb5 A T 12: 75,415,749 V22D probably damaging Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Hmces T C 6: 87,933,274 V222A possibly damaging Het
Kat14 T A 2: 144,373,782 D62E probably benign Het
Kcnmb2 T A 3: 32,181,869 V89E probably benign Het
Kif23 T A 9: 61,944,225 N63I probably benign Het
Lamc2 T C 1: 153,139,854 M578V probably benign Het
Ltbp2 A T 12: 84,789,153 C1335S probably benign Het
Lyst A G 13: 13,687,745 E2622G possibly damaging Het
Mctp1 A T 13: 76,384,674 H47L probably benign Het
Micalcl A G 7: 112,411,458 K618R probably damaging Het
Mllt6 T C 11: 97,665,760 I92T probably benign Het
Morc2a A G 11: 3,676,184 I223V probably benign Het
Msh3 A T 13: 92,345,086 I306N probably benign Het
Myo3b T A 2: 70,095,209 S35T probably benign Het
Nfkbiz A T 16: 55,813,984 V700E probably damaging Het
Oit3 T A 10: 59,441,683 M1L unknown Het
Olfr1048 A T 2: 86,236,472 I114K probably damaging Het
Olfr1231 A T 2: 89,302,731 I287N probably damaging Het
Olfr606 T A 7: 103,451,411 F25I probably benign Het
Peg3 T G 7: 6,707,999 D1408A probably damaging Het
Plaa A C 4: 94,586,883 S201R possibly damaging Het
Psmd5 A G 2: 34,854,326 S395P probably benign Het
Ralgapa2 T C 2: 146,334,554 I1701V probably damaging Het
Rrad T A 8: 104,629,727 probably null Het
Samm50 T A 15: 84,207,841 L339Q probably damaging Het
Scin T C 12: 40,104,958 E212G possibly damaging Het
Scrib T C 15: 76,067,299 D146G probably damaging Het
Slc19a1 G A 10: 77,049,771 D502N probably benign Het
Slc4a4 T C 5: 89,214,573 S839P probably damaging Het
Slc4a8 A G 15: 100,806,260 D764G probably damaging Het
Slc6a19 G A 13: 73,681,765 A590V probably damaging Het
Slfn8 G T 11: 83,017,706 H4N probably benign Het
Smad9 T A 3: 54,789,335 F274I possibly damaging Het
Snx4 A G 16: 33,286,010 E271G probably benign Het
Thap4 G A 1: 93,750,306 R253* probably null Het
Tmem65 T A 15: 58,790,179 I144F Het
Tnrc6a G A 7: 123,179,735 R1223Q probably benign Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Trpm2 T C 10: 77,911,392 Y1424C possibly damaging Het
Trrap T A 5: 144,826,668 Y2457N probably damaging Het
Vmn1r7 A G 6: 57,024,523 S251P probably damaging Het
Vmn2r89 A T 14: 51,456,012 E273V probably damaging Het
Vps52 A G 17: 33,962,182 D466G probably damaging Het
Xirp2 T C 2: 67,515,632 V2739A probably benign Het
Zc3h4 C T 7: 16,434,750 S1003F unknown Het
Zyg11a A T 4: 108,217,905 H6Q probably damaging Het
Other mutations in Rnf32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Rnf32 APN 5 29224274 missense probably damaging 1.00
IGL01786:Rnf32 APN 5 29206814 unclassified probably benign
IGL02832:Rnf32 APN 5 29205703 critical splice donor site probably null
IGL02976:Rnf32 APN 5 29206712 splice site probably null
R0038:Rnf32 UTSW 5 29205654 unclassified probably benign
R0038:Rnf32 UTSW 5 29205654 unclassified probably benign
R0070:Rnf32 UTSW 5 29225127 missense probably benign 0.00
R1812:Rnf32 UTSW 5 29206260 missense possibly damaging 0.88
R2279:Rnf32 UTSW 5 29225280 missense probably benign 0.36
R4903:Rnf32 UTSW 5 29198578 missense probably benign 0.00
R4964:Rnf32 UTSW 5 29198578 missense probably benign 0.00
R4966:Rnf32 UTSW 5 29198578 missense probably benign 0.00
R5155:Rnf32 UTSW 5 29203147 missense probably damaging 1.00
R5987:Rnf32 UTSW 5 29203147 missense probably damaging 1.00
R6060:Rnf32 UTSW 5 29206754 missense probably benign 0.01
R6374:Rnf32 UTSW 5 29225268 nonsense probably null
R7627:Rnf32 UTSW 5 29197950 start gained probably benign
R9161:Rnf32 UTSW 5 29203060 missense probably damaging 1.00
R9178:Rnf32 UTSW 5 29206213 missense possibly damaging 0.54
R9494:Rnf32 UTSW 5 29224147 missense probably damaging 1.00
R9794:Rnf32 UTSW 5 29224127 missense probably damaging 0.96
Z1176:Rnf32 UTSW 5 29225250 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATGACAGTCTCTGCATGC -3'
(R):5'- TTAGTAATCACATCCTGAGCTGC -3'

Sequencing Primer
(F):5'- ACAGTCTCTGCATGCATGAG -3'
(R):5'- GCTGCAAGCATCTGTCTCC -3'
Posted On 2022-06-15