Incidental Mutation 'R9457:Rnf32'
ID 714636
Institutional Source Beutler Lab
Gene Symbol Rnf32
Ensembl Gene ENSMUSG00000029130
Gene Name ring finger protein 32
Synonyms 4930542N22Rik, 2700025B22Rik, 1700009J01Rik, Lmbr2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 29400990-29433455 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 29411184 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 157 (A157T)
Ref Sequence ENSEMBL: ENSMUSP00000001247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001247] [ENSMUST00000160246] [ENSMUST00000160383] [ENSMUST00000160888] [ENSMUST00000161398] [ENSMUST00000168460] [ENSMUST00000198669]
AlphaFold Q9JIT1
Predicted Effect probably damaging
Transcript: ENSMUST00000001247
AA Change: A157T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001247
Gene: ENSMUSG00000029130
AA Change: A157T

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 97 107 N/A INTRINSIC
RING 129 170 4.8e-7 SMART
IQ 187 209 1.23e-1 SMART
RING 295 357 3.84e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160246
AA Change: A157T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124657
Gene: ENSMUSG00000029130
AA Change: A157T

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 97 107 N/A INTRINSIC
RING 129 170 4.8e-7 SMART
IQ 187 209 1.23e-1 SMART
RING 295 357 3.84e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160383
SMART Domains Protein: ENSMUSP00000125515
Gene: ENSMUSG00000029130

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160888
SMART Domains Protein: ENSMUSP00000124499
Gene: ENSMUSG00000029130

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 97 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161398
SMART Domains Protein: ENSMUSP00000125741
Gene: ENSMUSG00000029130

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 24 38 N/A INTRINSIC
low complexity region 80 90 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123952
Gene: ENSMUSG00000029130
AA Change: A119T

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 60 70 N/A INTRINSIC
RING 92 133 4.8e-7 SMART
IQ 150 172 1.23e-1 SMART
RING 202 264 3.84e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168460
AA Change: A157T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132213
Gene: ENSMUSG00000029130
AA Change: A157T

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 97 107 N/A INTRINSIC
RING 129 170 4.8e-7 SMART
IQ 187 209 1.23e-1 SMART
RING 295 357 3.84e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198669
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains two RING ring finger motifs. RING finger motifs are present in a variety of functionally distinct proteins and are known to be involved in protein-DNA or protein-protein interactions. This gene was found to be expressed during spermatogenesis, most likely in spermatocytes and/or in spermatids. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik T C 10: 115,414,236 (GRCm39) L54P unknown Het
Ablim3 A G 18: 61,978,920 (GRCm39) S204P probably benign Het
Acadl A G 1: 66,892,400 (GRCm39) V141A probably benign Het
Ace3 A G 11: 105,885,687 (GRCm39) D31G probably benign Het
Acte1 T C 7: 143,437,713 (GRCm39) V137A possibly damaging Het
Adam11 T G 11: 102,660,724 (GRCm39) V85G probably benign Het
Adarb1 A T 10: 77,157,982 (GRCm39) M155K possibly damaging Het
Arhgap10 G A 8: 78,111,415 (GRCm39) T376M probably benign Het
Bod1l G T 5: 41,979,310 (GRCm39) T668K probably damaging Het
Ccdc87 A G 19: 4,891,659 (GRCm39) E717G probably damaging Het
Cdh17 T A 4: 11,771,329 (GRCm39) I37N probably damaging Het
Cfap99 T G 5: 34,458,741 (GRCm39) F45L probably benign Het
Chsy1 C A 7: 65,822,148 (GRCm39) H794Q probably benign Het
Clec4a3 G A 6: 122,931,045 (GRCm39) V45I probably benign Het
Clic3 G A 2: 25,347,730 (GRCm39) V32I probably benign Het
Clip2 A T 5: 134,531,584 (GRCm39) D740E probably benign Het
Col5a2 C T 1: 45,426,004 (GRCm39) V1062I probably benign Het
Col5a2 A G 1: 45,431,973 (GRCm39) probably null Het
Cyp2j11 C T 4: 96,195,596 (GRCm39) V367I probably damaging Het
Ddr1 C T 17: 35,993,650 (GRCm39) A821T possibly damaging Het
Dna2 G A 10: 62,786,572 (GRCm39) E107K probably benign Het
Eif3d A G 15: 77,843,894 (GRCm39) V484A probably benign Het
Fgfr4 A G 13: 55,308,940 (GRCm39) T354A probably benign Het
Fkbp6 T C 5: 135,378,486 (GRCm39) D54G probably benign Het
Gm4787 T A 12: 81,426,020 (GRCm39) E46V probably damaging Het
Gm47995 A G 1: 151,074,226 (GRCm39) T10A possibly damaging Het
Gnb1l T A 16: 18,359,745 (GRCm39) I50N probably damaging Het
Gphb5 A T 12: 75,462,523 (GRCm39) V22D probably damaging Het
Gstt4 C T 10: 75,650,959 (GRCm39) C221Y probably benign Het
Hmces T C 6: 87,910,256 (GRCm39) V222A possibly damaging Het
Kat14 T A 2: 144,215,702 (GRCm39) D62E probably benign Het
Kcnmb2 T A 3: 32,236,018 (GRCm39) V89E probably benign Het
Kif23 T A 9: 61,851,507 (GRCm39) N63I probably benign Het
Lamc2 T C 1: 153,015,600 (GRCm39) M578V probably benign Het
Ltbp2 A T 12: 84,835,927 (GRCm39) C1335S probably benign Het
Lyst A G 13: 13,862,330 (GRCm39) E2622G possibly damaging Het
Mctp1 A T 13: 76,532,793 (GRCm39) H47L probably benign Het
Mical2 A G 7: 112,010,665 (GRCm39) K618R probably damaging Het
Mllt6 T C 11: 97,556,586 (GRCm39) I92T probably benign Het
Morc2a A G 11: 3,626,184 (GRCm39) I223V probably benign Het
Msh3 A T 13: 92,481,594 (GRCm39) I306N probably benign Het
Myo3b T A 2: 69,925,553 (GRCm39) S35T probably benign Het
Nfkbiz A T 16: 55,634,347 (GRCm39) V700E probably damaging Het
Oit3 T A 10: 59,277,505 (GRCm39) M1L unknown Het
Or4c1 A T 2: 89,133,075 (GRCm39) I287N probably damaging Het
Or51l14 T A 7: 103,100,618 (GRCm39) F25I probably benign Het
Or8k17 A T 2: 86,066,816 (GRCm39) I114K probably damaging Het
Peg3 T G 7: 6,710,998 (GRCm39) D1408A probably damaging Het
Plaa A C 4: 94,475,120 (GRCm39) S201R possibly damaging Het
Potefam1 A T 2: 111,000,631 (GRCm39) M196K unknown Het
Psmd5 A G 2: 34,744,338 (GRCm39) S395P probably benign Het
Ralgapa2 T C 2: 146,176,474 (GRCm39) I1701V probably damaging Het
Rmc1 A G 18: 12,312,303 (GRCm39) H181R probably benign Het
Rrad T A 8: 105,356,359 (GRCm39) probably null Het
Samm50 T A 15: 84,092,042 (GRCm39) L339Q probably damaging Het
Scin T C 12: 40,154,957 (GRCm39) E212G possibly damaging Het
Scrib T C 15: 75,939,148 (GRCm39) D146G probably damaging Het
Slc19a1 G A 10: 76,885,605 (GRCm39) D502N probably benign Het
Slc4a4 T C 5: 89,362,432 (GRCm39) S839P probably damaging Het
Slc4a8 A G 15: 100,704,141 (GRCm39) D764G probably damaging Het
Slc6a19 G A 13: 73,829,884 (GRCm39) A590V probably damaging Het
Slfn8 G T 11: 82,908,532 (GRCm39) H4N probably benign Het
Smad9 T A 3: 54,696,756 (GRCm39) F274I possibly damaging Het
Snx4 A G 16: 33,106,380 (GRCm39) E271G probably benign Het
Spata31h1 A G 10: 82,122,573 (GRCm39) V3479A probably benign Het
Tektip1 C A 10: 81,201,611 (GRCm39) V4L probably benign Het
Thap4 G A 1: 93,678,028 (GRCm39) R253* probably null Het
Tmem65 T A 15: 58,662,028 (GRCm39) I144F Het
Tnrc6a G A 7: 122,778,958 (GRCm39) R1223Q probably benign Het
Traf7 CA CAA 17: 24,746,737 (GRCm39) probably benign Het
Trpm2 T C 10: 77,747,226 (GRCm39) Y1424C possibly damaging Het
Trrap T A 5: 144,763,478 (GRCm39) Y2457N probably damaging Het
Vmn1r7 A G 6: 57,001,508 (GRCm39) S251P probably damaging Het
Vmn2r89 A T 14: 51,693,469 (GRCm39) E273V probably damaging Het
Vps52 A G 17: 34,181,156 (GRCm39) D466G probably damaging Het
Xirp2 T C 2: 67,345,976 (GRCm39) V2739A probably benign Het
Zc3h4 C T 7: 16,168,675 (GRCm39) S1003F unknown Het
Zyg11a A T 4: 108,075,102 (GRCm39) H6Q probably damaging Het
Other mutations in Rnf32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Rnf32 APN 5 29,429,272 (GRCm39) missense probably damaging 1.00
IGL01786:Rnf32 APN 5 29,411,812 (GRCm39) unclassified probably benign
IGL02832:Rnf32 APN 5 29,410,701 (GRCm39) critical splice donor site probably null
IGL02976:Rnf32 APN 5 29,411,710 (GRCm39) splice site probably null
R0038:Rnf32 UTSW 5 29,410,652 (GRCm39) unclassified probably benign
R0038:Rnf32 UTSW 5 29,410,652 (GRCm39) unclassified probably benign
R0070:Rnf32 UTSW 5 29,430,125 (GRCm39) missense probably benign 0.00
R1812:Rnf32 UTSW 5 29,411,258 (GRCm39) missense possibly damaging 0.88
R2279:Rnf32 UTSW 5 29,430,278 (GRCm39) missense probably benign 0.36
R4903:Rnf32 UTSW 5 29,403,576 (GRCm39) missense probably benign 0.00
R4964:Rnf32 UTSW 5 29,403,576 (GRCm39) missense probably benign 0.00
R4966:Rnf32 UTSW 5 29,403,576 (GRCm39) missense probably benign 0.00
R5155:Rnf32 UTSW 5 29,408,145 (GRCm39) missense probably damaging 1.00
R5987:Rnf32 UTSW 5 29,408,145 (GRCm39) missense probably damaging 1.00
R6060:Rnf32 UTSW 5 29,411,752 (GRCm39) missense probably benign 0.01
R6374:Rnf32 UTSW 5 29,430,266 (GRCm39) nonsense probably null
R7627:Rnf32 UTSW 5 29,402,948 (GRCm39) start gained probably benign
R9161:Rnf32 UTSW 5 29,408,058 (GRCm39) missense probably damaging 1.00
R9178:Rnf32 UTSW 5 29,411,211 (GRCm39) missense possibly damaging 0.54
R9494:Rnf32 UTSW 5 29,429,145 (GRCm39) missense probably damaging 1.00
R9794:Rnf32 UTSW 5 29,429,125 (GRCm39) missense probably damaging 0.96
Z1176:Rnf32 UTSW 5 29,430,248 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATGACAGTCTCTGCATGC -3'
(R):5'- TTAGTAATCACATCCTGAGCTGC -3'

Sequencing Primer
(F):5'- ACAGTCTCTGCATGCATGAG -3'
(R):5'- GCTGCAAGCATCTGTCTCC -3'
Posted On 2022-06-15