Mutagenetix > Incidental Mutation

Incidental Mutation 'R9457:Bod1l'

714638

Institutional Source

Beutler Lab

Gene Symbol

Bod1l

Ensembl Gene

ENSMUSG00000061755

Gene Name

biorientation of chromosomes in cell division 1-like

Synonyms

A230054D04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R9457 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41787538-41844315 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 41821967 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 668 (T668K)

Ref Sequence

ENSEMBL: ENSMUSP00000058618 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000050556
AA Change: T668K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: T668K

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	1.8e-28	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	3.21e-1	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202908
AA Change: T668K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: T668K

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	2.9e-24	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	1.9e-3	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	A	G	18: 12,179,246	H181R	probably benign	Het
4930404N11Rik	C	A	10: 81,365,777	V4L	probably benign	Het
4930430A15Rik	A	T	2: 111,170,286	M196K	unknown	Het
4932415D10Rik	A	G	10: 82,286,739	V3479A	probably benign	Het
A930009A15Rik	T	C	10: 115,578,331	L54P	unknown	Het
Ablim3	A	G	18: 61,845,849	S204P	probably benign	Het
Acadl	A	G	1: 66,853,241	V141A	probably benign	Het
Ace3	A	G	11: 105,994,861	D31G	probably benign	Het
Adam11	T	G	11: 102,769,898	V85G	probably benign	Het
Adarb1	A	T	10: 77,322,148	M155K	possibly damaging	Het
Arhgap10	G	A	8: 77,384,786	T376M	probably benign	Het
Ccdc87	A	G	19: 4,841,631	E717G	probably damaging	Het
Cdh17	T	A	4: 11,771,329	I37N	probably damaging	Het
Cfap99	T	G	5: 34,301,397	F45L	probably benign	Het
Chsy1	C	A	7: 66,172,400	H794Q	probably benign	Het
Clec4a3	G	A	6: 122,954,086	V45I	probably benign	Het
Clic3	G	A	2: 25,457,718	V32I	probably benign	Het
Clip2	A	T	5: 134,502,730	D740E	probably benign	Het
Col5a2	C	T	1: 45,386,844	V1062I	probably benign	Het
Col5a2	A	G	1: 45,392,813		probably null	Het
Cyp2j11	C	T	4: 96,307,359	V367I	probably damaging	Het
Ddr1	C	T	17: 35,682,758	A821T	possibly damaging	Het
Dna2	G	A	10: 62,950,793	E107K	probably benign	Het
Eif3d	A	G	15: 77,959,694	V484A	probably benign	Het
Fgfr4	A	G	13: 55,161,127	T354A	probably benign	Het
Fkbp6	T	C	5: 135,349,632	D54G	probably benign	Het
Gm4787	T	A	12: 81,379,246	E46V	probably damaging	Het
Gm47995	A	G	1: 151,198,475	T10A	possibly damaging	Het
Gm498	T	C	7: 143,883,976	V137A	possibly damaging	Het
Gnb1l	T	A	16: 18,540,995	I50N	probably damaging	Het
Gphb5	A	T	12: 75,415,749	V22D	probably damaging	Het
Gstt4	C	T	10: 75,815,125	C221Y	probably benign	Het
Hmces	T	C	6: 87,933,274	V222A	possibly damaging	Het
Kat14	T	A	2: 144,373,782	D62E	probably benign	Het
Kcnmb2	T	A	3: 32,181,869	V89E	probably benign	Het
Kif23	T	A	9: 61,944,225	N63I	probably benign	Het
Lamc2	T	C	1: 153,139,854	M578V	probably benign	Het
Ltbp2	A	T	12: 84,789,153	C1335S	probably benign	Het
Lyst	A	G	13: 13,687,745	E2622G	possibly damaging	Het
Mctp1	A	T	13: 76,384,674	H47L	probably benign	Het
Micalcl	A	G	7: 112,411,458	K618R	probably damaging	Het
Mllt6	T	C	11: 97,665,760	I92T	probably benign	Het
Morc2a	A	G	11: 3,676,184	I223V	probably benign	Het
Msh3	A	T	13: 92,345,086	I306N	probably benign	Het
Myo3b	T	A	2: 70,095,209	S35T	probably benign	Het
Nfkbiz	A	T	16: 55,813,984	V700E	probably damaging	Het
Oit3	T	A	10: 59,441,683	M1L	unknown	Het
Olfr1048	A	T	2: 86,236,472	I114K	probably damaging	Het
Olfr1231	A	T	2: 89,302,731	I287N	probably damaging	Het
Olfr606	T	A	7: 103,451,411	F25I	probably benign	Het
Peg3	T	G	7: 6,707,999	D1408A	probably damaging	Het
Plaa	A	C	4: 94,586,883	S201R	possibly damaging	Het
Psmd5	A	G	2: 34,854,326	S395P	probably benign	Het
Ralgapa2	T	C	2: 146,334,554	I1701V	probably damaging	Het
Rnf32	G	A	5: 29,206,186	A157T	probably damaging	Het
Rrad	T	A	8: 104,629,727		probably null	Het
Samm50	T	A	15: 84,207,841	L339Q	probably damaging	Het
Scin	T	C	12: 40,104,958	E212G	possibly damaging	Het
Scrib	T	C	15: 76,067,299	D146G	probably damaging	Het
Slc19a1	G	A	10: 77,049,771	D502N	probably benign	Het
Slc4a4	T	C	5: 89,214,573	S839P	probably damaging	Het
Slc4a8	A	G	15: 100,806,260	D764G	probably damaging	Het
Slc6a19	G	A	13: 73,681,765	A590V	probably damaging	Het
Slfn8	G	T	11: 83,017,706	H4N	probably benign	Het
Smad9	T	A	3: 54,789,335	F274I	possibly damaging	Het
Snx4	A	G	16: 33,286,010	E271G	probably benign	Het
Thap4	G	A	1: 93,750,306	R253*	probably null	Het
Tmem65	T	A	15: 58,790,179	I144F		Het
Tnrc6a	G	A	7: 123,179,735	R1223Q	probably benign	Het
Traf7	CA	CAA	17: 24,527,763		probably benign	Het
Trpm2	T	C	10: 77,911,392	Y1424C	possibly damaging	Het
Trrap	T	A	5: 144,826,668	Y2457N	probably damaging	Het
Vmn1r7	A	G	6: 57,024,523	S251P	probably damaging	Het
Vmn2r89	A	T	14: 51,456,012	E273V	probably damaging	Het
Vps52	A	G	17: 33,962,182	D466G	probably damaging	Het
Xirp2	T	C	2: 67,515,632	V2739A	probably benign	Het
Zc3h4	C	T	7: 16,434,750	S1003F	unknown	Het
Zyg11a	A	T	4: 108,217,905	H6Q	probably damaging	Het

Other mutations in Bod1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Bod1l	APN	5	41816823	missense	probably benign	0.00
IGL00990:Bod1l	APN	5	41828865	missense	probably benign	0.00
IGL01021:Bod1l	APN	5	41838173	splice site	probably benign
IGL01022:Bod1l	APN	5	41794309	missense	probably damaging	1.00
IGL01303:Bod1l	APN	5	41817599	missense	probably benign	0.00
IGL01654:Bod1l	APN	5	41818176	missense	probably damaging	0.99
IGL01748:Bod1l	APN	5	41816961	missense	probably benign	0.23
IGL01758:Bod1l	APN	5	41826610	splice site	probably benign
IGL01783:Bod1l	APN	5	41808712	missense	probably benign	0.02
IGL01790:Bod1l	APN	5	41832250	missense	probably benign	0.14
IGL01803:Bod1l	APN	5	41817389	missense	probably damaging	0.97
IGL01829:Bod1l	APN	5	41820468	missense	probably benign	0.25
IGL01952:Bod1l	APN	5	41816954	missense	possibly damaging	0.70
IGL02005:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02110:Bod1l	APN	5	41816453	missense	probably damaging	0.97
IGL02129:Bod1l	APN	5	41821850	missense	probably benign	0.36
IGL02572:Bod1l	APN	5	41821230	nonsense	probably null
IGL02583:Bod1l	APN	5	41816207	critical splice donor site	probably null
IGL02643:Bod1l	APN	5	41818805	missense	possibly damaging	0.65
IGL02714:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02728:Bod1l	APN	5	41826503	missense	probably damaging	1.00
IGL02752:Bod1l	APN	5	41816463	missense	possibly damaging	0.58
IGL02822:Bod1l	APN	5	41794345	missense	possibly damaging	0.94
IGL03032:Bod1l	APN	5	41831584	missense	probably benign	0.16
IGL03372:Bod1l	APN	5	41805235	splice site	probably benign
capacitance	UTSW	5	41791813	missense	possibly damaging	0.91
gauss	UTSW	5	41816867	missense	probably benign	0.01
Tesla	UTSW	5	41795068	critical splice donor site	probably null
R0102:Bod1l	UTSW	5	41817269	missense	probably benign	0.36
R0147:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0148:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0490:Bod1l	UTSW	5	41821892	missense	probably damaging	0.96
R0577:Bod1l	UTSW	5	41794887	missense	probably damaging	1.00
R0587:Bod1l	UTSW	5	41821637	missense	probably benign	0.16
R0620:Bod1l	UTSW	5	41801233	missense	probably benign	0.16
R0626:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R0785:Bod1l	UTSW	5	41820016	missense	probably benign	0.00
R1139:Bod1l	UTSW	5	41831471	missense	possibly damaging	0.64
R1165:Bod1l	UTSW	5	41821053	missense	probably benign	0.02
R1418:Bod1l	UTSW	5	41819471	missense	probably damaging	1.00
R1509:Bod1l	UTSW	5	41819540	missense	probably damaging	0.99
R1533:Bod1l	UTSW	5	41822155	nonsense	probably null
R1538:Bod1l	UTSW	5	41816429	missense	probably benign	0.00
R1591:Bod1l	UTSW	5	41819220	missense	probably benign	0.06
R1616:Bod1l	UTSW	5	41808715	missense	probably benign
R1628:Bod1l	UTSW	5	41816982	missense	probably benign	0.01
R1667:Bod1l	UTSW	5	41816775	missense	probably benign	0.01
R1869:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1870:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1993:Bod1l	UTSW	5	41817336	missense	probably damaging	1.00
R2060:Bod1l	UTSW	5	41808742	missense	possibly damaging	0.58
R2066:Bod1l	UTSW	5	41805156	missense	probably damaging	0.99
R2067:Bod1l	UTSW	5	41817086	missense	probably benign	0.11
R2073:Bod1l	UTSW	5	41819189	missense	probably benign	0.19
R2092:Bod1l	UTSW	5	41831517	missense	probably damaging	1.00
R2105:Bod1l	UTSW	5	41832279	missense	probably benign	0.00
R2243:Bod1l	UTSW	5	41821545	missense	possibly damaging	0.58
R2322:Bod1l	UTSW	5	41827120	missense	probably benign	0.09
R2849:Bod1l	UTSW	5	41838076	missense	probably damaging	1.00
R2883:Bod1l	UTSW	5	41832259	missense	probably benign	0.03
R3037:Bod1l	UTSW	5	41822037	missense	probably damaging	0.99
R3910:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3911:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3962:Bod1l	UTSW	5	41808721	missense	probably benign	0.07
R4235:Bod1l	UTSW	5	41821455	missense	probably damaging	1.00
R4308:Bod1l	UTSW	5	41791813	missense	possibly damaging	0.91
R4414:Bod1l	UTSW	5	41820527	missense	probably benign	0.04
R4535:Bod1l	UTSW	5	41832231	missense	probably benign	0.06
R4631:Bod1l	UTSW	5	41817735	missense	probably damaging	1.00
R4657:Bod1l	UTSW	5	41818612	missense	probably benign	0.00
R4782:Bod1l	UTSW	5	41833663	missense	probably benign	0.06
R4786:Bod1l	UTSW	5	41819438	missense	probably benign	0.43
R4840:Bod1l	UTSW	5	41818472	missense	probably damaging	1.00
R4877:Bod1l	UTSW	5	41819994	missense	probably benign	0.00
R4982:Bod1l	UTSW	5	41820473	missense	probably benign	0.00
R5152:Bod1l	UTSW	5	41816543	missense	probably benign	0.04
R5284:Bod1l	UTSW	5	41820467	missense	probably benign	0.05
R5354:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R5369:Bod1l	UTSW	5	41827183	missense	probably damaging	1.00
R5486:Bod1l	UTSW	5	41807181	missense	possibly damaging	0.56
R5541:Bod1l	UTSW	5	41791933	missense	probably benign	0.06
R5610:Bod1l	UTSW	5	41821874	missense	probably damaging	1.00
R5655:Bod1l	UTSW	5	41817044	missense	probably benign	0.06
R5705:Bod1l	UTSW	5	41817002	missense	probably benign	0.01
R5819:Bod1l	UTSW	5	41832605	missense	probably benign	0.27
R5890:Bod1l	UTSW	5	41820578	missense	probably benign	0.43
R5923:Bod1l	UTSW	5	41817419	missense	probably damaging	1.00
R5991:Bod1l	UTSW	5	41816863	nonsense	probably null
R6017:Bod1l	UTSW	5	41818760	missense	probably benign	0.01
R6253:Bod1l	UTSW	5	41826538	missense	probably damaging	0.96
R6284:Bod1l	UTSW	5	41818787	missense	probably benign	0.35
R6483:Bod1l	UTSW	5	41821082	missense	probably benign	0.03
R6485:Bod1l	UTSW	5	41817116	missense	possibly damaging	0.93
R6575:Bod1l	UTSW	5	41838068	missense	probably damaging	1.00
R6679:Bod1l	UTSW	5	41816666	missense	probably damaging	0.97
R6788:Bod1l	UTSW	5	41821873	nonsense	probably null
R7006:Bod1l	UTSW	5	41832552	missense	probably damaging	1.00
R7095:Bod1l	UTSW	5	41795068	critical splice donor site	probably null
R7111:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7190:Bod1l	UTSW	5	41819938	missense	probably benign	0.14
R7311:Bod1l	UTSW	5	41794333	missense	possibly damaging	0.57
R7336:Bod1l	UTSW	5	41821524	missense	probably damaging	1.00
R7341:Bod1l	UTSW	5	41788857	missense	probably benign	0.00
R7396:Bod1l	UTSW	5	41831546	missense	probably damaging	1.00
R7431:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7442:Bod1l	UTSW	5	41807179	missense	probably damaging	0.96
R7539:Bod1l	UTSW	5	41817860	missense	possibly damaging	0.65
R7583:Bod1l	UTSW	5	41833790	missense	probably damaging	1.00
R7679:Bod1l	UTSW	5	41820643	frame shift	probably null
R7748:Bod1l	UTSW	5	41832340	missense	probably damaging	0.97
R7767:Bod1l	UTSW	5	41816756	missense	probably benign	0.01
R7773:Bod1l	UTSW	5	41832712	missense	probably benign	0.14
R7782:Bod1l	UTSW	5	41817943	missense	probably benign	0.01
R7860:Bod1l	UTSW	5	41819265	missense	probably damaging	1.00
R7975:Bod1l	UTSW	5	41816277	missense	possibly damaging	0.90
R7977:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R7987:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R8104:Bod1l	UTSW	5	41833732	nonsense	probably null
R8217:Bod1l	UTSW	5	41831507	missense	probably damaging	1.00
R8307:Bod1l	UTSW	5	41821155	missense	probably damaging	1.00
R8469:Bod1l	UTSW	5	41821491	missense	possibly damaging	0.86
R8506:Bod1l	UTSW	5	41819055	nonsense	probably null
R8934:Bod1l	UTSW	5	41819601	missense	probably benign	0.11
R8984:Bod1l	UTSW	5	41788872	missense	probably damaging	1.00
R8989:Bod1l	UTSW	5	41821682	missense	probably benign	0.00
R8993:Bod1l	UTSW	5	41816867	missense	probably benign	0.01
R9128:Bod1l	UTSW	5	41788923	missense	probably benign	0.22
R9129:Bod1l	UTSW	5	41818877	missense	probably damaging	0.99
R9198:Bod1l	UTSW	5	41799786	missense	probably benign	0.08
R9254:Bod1l	UTSW	5	41821880	missense	probably damaging	1.00
R9445:Bod1l	UTSW	5	41817276	missense	probably benign	0.04
R9470:Bod1l	UTSW	5	41817096	missense	probably damaging	0.99
R9536:Bod1l	UTSW	5	41816962	missense	probably benign	0.01
R9654:Bod1l	UTSW	5	41818364	missense	probably benign	0.02
R9734:Bod1l	UTSW	5	41805230	missense	possibly damaging	0.91
R9771:Bod1l	UTSW	5	41791863	missense	probably damaging	0.96
X0027:Bod1l	UTSW	5	41832669	missense	probably benign	0.20
X0058:Bod1l	UTSW	5	41824018	missense	probably damaging	1.00
Z1088:Bod1l	UTSW	5	41808764	missense	possibly damaging	0.95
Z1088:Bod1l	UTSW	5	41821146	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACACTGTCACCTTTGTG -3'
(R):5'- AAAAGGCCTCTTCCAAGGAC -3'

Sequencing Primer
(F):5'- ACACTGTCACCTTTGTGTTTGTG -3'
(R):5'- TCTTCCAAGGACCTCAGGC -3'

Posted On

2022-06-15