Incidental Mutation 'R9457:Bod1l'
ID 714638
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Name biorientation of chromosomes in cell division 1-like
Synonyms A230054D04Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.957) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 41944881-42001658 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 41979310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 668 (T668K)
Ref Sequence ENSEMBL: ENSMUSP00000058618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000050556
AA Change: T668K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: T668K

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202908
AA Change: T668K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: T668K

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik T C 10: 115,414,236 (GRCm39) L54P unknown Het
Ablim3 A G 18: 61,978,920 (GRCm39) S204P probably benign Het
Acadl A G 1: 66,892,400 (GRCm39) V141A probably benign Het
Ace3 A G 11: 105,885,687 (GRCm39) D31G probably benign Het
Acte1 T C 7: 143,437,713 (GRCm39) V137A possibly damaging Het
Adam11 T G 11: 102,660,724 (GRCm39) V85G probably benign Het
Adarb1 A T 10: 77,157,982 (GRCm39) M155K possibly damaging Het
Arhgap10 G A 8: 78,111,415 (GRCm39) T376M probably benign Het
Ccdc87 A G 19: 4,891,659 (GRCm39) E717G probably damaging Het
Cdh17 T A 4: 11,771,329 (GRCm39) I37N probably damaging Het
Cfap99 T G 5: 34,458,741 (GRCm39) F45L probably benign Het
Chsy1 C A 7: 65,822,148 (GRCm39) H794Q probably benign Het
Clec4a3 G A 6: 122,931,045 (GRCm39) V45I probably benign Het
Clic3 G A 2: 25,347,730 (GRCm39) V32I probably benign Het
Clip2 A T 5: 134,531,584 (GRCm39) D740E probably benign Het
Col5a2 C T 1: 45,426,004 (GRCm39) V1062I probably benign Het
Col5a2 A G 1: 45,431,973 (GRCm39) probably null Het
Cyp2j11 C T 4: 96,195,596 (GRCm39) V367I probably damaging Het
Ddr1 C T 17: 35,993,650 (GRCm39) A821T possibly damaging Het
Dna2 G A 10: 62,786,572 (GRCm39) E107K probably benign Het
Eif3d A G 15: 77,843,894 (GRCm39) V484A probably benign Het
Fgfr4 A G 13: 55,308,940 (GRCm39) T354A probably benign Het
Fkbp6 T C 5: 135,378,486 (GRCm39) D54G probably benign Het
Gm4787 T A 12: 81,426,020 (GRCm39) E46V probably damaging Het
Gm47995 A G 1: 151,074,226 (GRCm39) T10A possibly damaging Het
Gnb1l T A 16: 18,359,745 (GRCm39) I50N probably damaging Het
Gphb5 A T 12: 75,462,523 (GRCm39) V22D probably damaging Het
Gstt4 C T 10: 75,650,959 (GRCm39) C221Y probably benign Het
Hmces T C 6: 87,910,256 (GRCm39) V222A possibly damaging Het
Kat14 T A 2: 144,215,702 (GRCm39) D62E probably benign Het
Kcnmb2 T A 3: 32,236,018 (GRCm39) V89E probably benign Het
Kif23 T A 9: 61,851,507 (GRCm39) N63I probably benign Het
Lamc2 T C 1: 153,015,600 (GRCm39) M578V probably benign Het
Ltbp2 A T 12: 84,835,927 (GRCm39) C1335S probably benign Het
Lyst A G 13: 13,862,330 (GRCm39) E2622G possibly damaging Het
Mctp1 A T 13: 76,532,793 (GRCm39) H47L probably benign Het
Mical2 A G 7: 112,010,665 (GRCm39) K618R probably damaging Het
Mllt6 T C 11: 97,556,586 (GRCm39) I92T probably benign Het
Morc2a A G 11: 3,626,184 (GRCm39) I223V probably benign Het
Msh3 A T 13: 92,481,594 (GRCm39) I306N probably benign Het
Myo3b T A 2: 69,925,553 (GRCm39) S35T probably benign Het
Nfkbiz A T 16: 55,634,347 (GRCm39) V700E probably damaging Het
Oit3 T A 10: 59,277,505 (GRCm39) M1L unknown Het
Or4c1 A T 2: 89,133,075 (GRCm39) I287N probably damaging Het
Or51l14 T A 7: 103,100,618 (GRCm39) F25I probably benign Het
Or8k17 A T 2: 86,066,816 (GRCm39) I114K probably damaging Het
Peg3 T G 7: 6,710,998 (GRCm39) D1408A probably damaging Het
Plaa A C 4: 94,475,120 (GRCm39) S201R possibly damaging Het
Potefam1 A T 2: 111,000,631 (GRCm39) M196K unknown Het
Psmd5 A G 2: 34,744,338 (GRCm39) S395P probably benign Het
Ralgapa2 T C 2: 146,176,474 (GRCm39) I1701V probably damaging Het
Rmc1 A G 18: 12,312,303 (GRCm39) H181R probably benign Het
Rnf32 G A 5: 29,411,184 (GRCm39) A157T probably damaging Het
Rrad T A 8: 105,356,359 (GRCm39) probably null Het
Samm50 T A 15: 84,092,042 (GRCm39) L339Q probably damaging Het
Scin T C 12: 40,154,957 (GRCm39) E212G possibly damaging Het
Scrib T C 15: 75,939,148 (GRCm39) D146G probably damaging Het
Slc19a1 G A 10: 76,885,605 (GRCm39) D502N probably benign Het
Slc4a4 T C 5: 89,362,432 (GRCm39) S839P probably damaging Het
Slc4a8 A G 15: 100,704,141 (GRCm39) D764G probably damaging Het
Slc6a19 G A 13: 73,829,884 (GRCm39) A590V probably damaging Het
Slfn8 G T 11: 82,908,532 (GRCm39) H4N probably benign Het
Smad9 T A 3: 54,696,756 (GRCm39) F274I possibly damaging Het
Snx4 A G 16: 33,106,380 (GRCm39) E271G probably benign Het
Spata31h1 A G 10: 82,122,573 (GRCm39) V3479A probably benign Het
Tektip1 C A 10: 81,201,611 (GRCm39) V4L probably benign Het
Thap4 G A 1: 93,678,028 (GRCm39) R253* probably null Het
Tmem65 T A 15: 58,662,028 (GRCm39) I144F Het
Tnrc6a G A 7: 122,778,958 (GRCm39) R1223Q probably benign Het
Traf7 CA CAA 17: 24,746,737 (GRCm39) probably benign Het
Trpm2 T C 10: 77,747,226 (GRCm39) Y1424C possibly damaging Het
Trrap T A 5: 144,763,478 (GRCm39) Y2457N probably damaging Het
Vmn1r7 A G 6: 57,001,508 (GRCm39) S251P probably damaging Het
Vmn2r89 A T 14: 51,693,469 (GRCm39) E273V probably damaging Het
Vps52 A G 17: 34,181,156 (GRCm39) D466G probably damaging Het
Xirp2 T C 2: 67,345,976 (GRCm39) V2739A probably benign Het
Zc3h4 C T 7: 16,168,675 (GRCm39) S1003F unknown Het
Zyg11a A T 4: 108,075,102 (GRCm39) H6Q probably damaging Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41,974,166 (GRCm39) missense probably benign 0.00
IGL00990:Bod1l APN 5 41,986,208 (GRCm39) missense probably benign 0.00
IGL01021:Bod1l APN 5 41,995,516 (GRCm39) splice site probably benign
IGL01022:Bod1l APN 5 41,951,652 (GRCm39) missense probably damaging 1.00
IGL01303:Bod1l APN 5 41,974,942 (GRCm39) missense probably benign 0.00
IGL01654:Bod1l APN 5 41,975,519 (GRCm39) missense probably damaging 0.99
IGL01748:Bod1l APN 5 41,974,304 (GRCm39) missense probably benign 0.23
IGL01758:Bod1l APN 5 41,983,953 (GRCm39) splice site probably benign
IGL01783:Bod1l APN 5 41,966,055 (GRCm39) missense probably benign 0.02
IGL01790:Bod1l APN 5 41,989,593 (GRCm39) missense probably benign 0.14
IGL01803:Bod1l APN 5 41,974,732 (GRCm39) missense probably damaging 0.97
IGL01829:Bod1l APN 5 41,977,811 (GRCm39) missense probably benign 0.25
IGL01952:Bod1l APN 5 41,974,297 (GRCm39) missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41,973,682 (GRCm39) missense probably benign 0.01
IGL02110:Bod1l APN 5 41,973,796 (GRCm39) missense probably damaging 0.97
IGL02129:Bod1l APN 5 41,979,193 (GRCm39) missense probably benign 0.36
IGL02572:Bod1l APN 5 41,978,573 (GRCm39) nonsense probably null
IGL02583:Bod1l APN 5 41,973,550 (GRCm39) critical splice donor site probably null
IGL02643:Bod1l APN 5 41,976,148 (GRCm39) missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41,973,682 (GRCm39) missense probably benign 0.01
IGL02728:Bod1l APN 5 41,983,846 (GRCm39) missense probably damaging 1.00
IGL02752:Bod1l APN 5 41,973,806 (GRCm39) missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41,951,688 (GRCm39) missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41,988,927 (GRCm39) missense probably benign 0.16
IGL03372:Bod1l APN 5 41,962,578 (GRCm39) splice site probably benign
capacitance UTSW 5 41,949,156 (GRCm39) missense possibly damaging 0.91
gauss UTSW 5 41,974,210 (GRCm39) missense probably benign 0.01
Tesla UTSW 5 41,952,411 (GRCm39) critical splice donor site probably null
R0102:Bod1l UTSW 5 41,974,612 (GRCm39) missense probably benign 0.36
R0147:Bod1l UTSW 5 41,976,040 (GRCm39) missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41,976,040 (GRCm39) missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41,979,235 (GRCm39) missense probably damaging 0.96
R0577:Bod1l UTSW 5 41,952,230 (GRCm39) missense probably damaging 1.00
R0587:Bod1l UTSW 5 41,978,980 (GRCm39) missense probably benign 0.16
R0620:Bod1l UTSW 5 41,958,576 (GRCm39) missense probably benign 0.16
R0626:Bod1l UTSW 5 41,988,880 (GRCm39) missense probably damaging 1.00
R0785:Bod1l UTSW 5 41,977,359 (GRCm39) missense probably benign 0.00
R1139:Bod1l UTSW 5 41,988,814 (GRCm39) missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41,978,396 (GRCm39) missense probably benign 0.02
R1418:Bod1l UTSW 5 41,976,814 (GRCm39) missense probably damaging 1.00
R1509:Bod1l UTSW 5 41,976,883 (GRCm39) missense probably damaging 0.99
R1533:Bod1l UTSW 5 41,979,498 (GRCm39) nonsense probably null
R1538:Bod1l UTSW 5 41,973,772 (GRCm39) missense probably benign 0.00
R1591:Bod1l UTSW 5 41,976,563 (GRCm39) missense probably benign 0.06
R1616:Bod1l UTSW 5 41,966,058 (GRCm39) missense probably benign
R1628:Bod1l UTSW 5 41,974,325 (GRCm39) missense probably benign 0.01
R1667:Bod1l UTSW 5 41,974,118 (GRCm39) missense probably benign 0.01
R1869:Bod1l UTSW 5 41,991,018 (GRCm39) missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41,991,018 (GRCm39) missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41,974,679 (GRCm39) missense probably damaging 1.00
R2060:Bod1l UTSW 5 41,966,085 (GRCm39) missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41,962,499 (GRCm39) missense probably damaging 0.99
R2067:Bod1l UTSW 5 41,974,429 (GRCm39) missense probably benign 0.11
R2073:Bod1l UTSW 5 41,976,532 (GRCm39) missense probably benign 0.19
R2092:Bod1l UTSW 5 41,988,860 (GRCm39) missense probably damaging 1.00
R2105:Bod1l UTSW 5 41,989,622 (GRCm39) missense probably benign 0.00
R2243:Bod1l UTSW 5 41,978,888 (GRCm39) missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41,984,463 (GRCm39) missense probably benign 0.09
R2849:Bod1l UTSW 5 41,995,419 (GRCm39) missense probably damaging 1.00
R2883:Bod1l UTSW 5 41,989,602 (GRCm39) missense probably benign 0.03
R3037:Bod1l UTSW 5 41,979,380 (GRCm39) missense probably damaging 0.99
R3910:Bod1l UTSW 5 41,974,441 (GRCm39) missense probably damaging 0.99
R3911:Bod1l UTSW 5 41,974,441 (GRCm39) missense probably damaging 0.99
R3962:Bod1l UTSW 5 41,966,064 (GRCm39) missense probably benign 0.07
R4235:Bod1l UTSW 5 41,978,798 (GRCm39) missense probably damaging 1.00
R4308:Bod1l UTSW 5 41,949,156 (GRCm39) missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41,977,870 (GRCm39) missense probably benign 0.04
R4535:Bod1l UTSW 5 41,989,574 (GRCm39) missense probably benign 0.06
R4631:Bod1l UTSW 5 41,975,078 (GRCm39) missense probably damaging 1.00
R4657:Bod1l UTSW 5 41,975,955 (GRCm39) missense probably benign 0.00
R4782:Bod1l UTSW 5 41,991,006 (GRCm39) missense probably benign 0.06
R4786:Bod1l UTSW 5 41,976,781 (GRCm39) missense probably benign 0.43
R4840:Bod1l UTSW 5 41,975,815 (GRCm39) missense probably damaging 1.00
R4877:Bod1l UTSW 5 41,977,337 (GRCm39) missense probably benign 0.00
R4982:Bod1l UTSW 5 41,977,816 (GRCm39) missense probably benign 0.00
R5152:Bod1l UTSW 5 41,973,886 (GRCm39) missense probably benign 0.04
R5284:Bod1l UTSW 5 41,977,810 (GRCm39) missense probably benign 0.05
R5354:Bod1l UTSW 5 41,988,880 (GRCm39) missense probably damaging 1.00
R5369:Bod1l UTSW 5 41,984,526 (GRCm39) missense probably damaging 1.00
R5486:Bod1l UTSW 5 41,964,524 (GRCm39) missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41,949,276 (GRCm39) missense probably benign 0.06
R5610:Bod1l UTSW 5 41,979,217 (GRCm39) missense probably damaging 1.00
R5655:Bod1l UTSW 5 41,974,387 (GRCm39) missense probably benign 0.06
R5705:Bod1l UTSW 5 41,974,345 (GRCm39) missense probably benign 0.01
R5819:Bod1l UTSW 5 41,989,948 (GRCm39) missense probably benign 0.27
R5890:Bod1l UTSW 5 41,977,921 (GRCm39) missense probably benign 0.43
R5923:Bod1l UTSW 5 41,974,762 (GRCm39) missense probably damaging 1.00
R5991:Bod1l UTSW 5 41,974,206 (GRCm39) nonsense probably null
R6017:Bod1l UTSW 5 41,976,103 (GRCm39) missense probably benign 0.01
R6253:Bod1l UTSW 5 41,983,881 (GRCm39) missense probably damaging 0.96
R6284:Bod1l UTSW 5 41,976,130 (GRCm39) missense probably benign 0.35
R6483:Bod1l UTSW 5 41,978,425 (GRCm39) missense probably benign 0.03
R6485:Bod1l UTSW 5 41,974,459 (GRCm39) missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41,995,411 (GRCm39) missense probably damaging 1.00
R6679:Bod1l UTSW 5 41,974,009 (GRCm39) missense probably damaging 0.97
R6788:Bod1l UTSW 5 41,979,216 (GRCm39) nonsense probably null
R7006:Bod1l UTSW 5 41,989,895 (GRCm39) missense probably damaging 1.00
R7095:Bod1l UTSW 5 41,952,411 (GRCm39) critical splice donor site probably null
R7111:Bod1l UTSW 5 41,970,463 (GRCm39) critical splice donor site probably null
R7190:Bod1l UTSW 5 41,977,281 (GRCm39) missense probably benign 0.14
R7311:Bod1l UTSW 5 41,951,676 (GRCm39) missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41,978,867 (GRCm39) missense probably damaging 1.00
R7341:Bod1l UTSW 5 41,946,200 (GRCm39) missense probably benign 0.00
R7396:Bod1l UTSW 5 41,988,889 (GRCm39) missense probably damaging 1.00
R7431:Bod1l UTSW 5 41,970,463 (GRCm39) critical splice donor site probably null
R7442:Bod1l UTSW 5 41,964,522 (GRCm39) missense probably damaging 0.96
R7539:Bod1l UTSW 5 41,975,203 (GRCm39) missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41,991,133 (GRCm39) missense probably damaging 1.00
R7679:Bod1l UTSW 5 41,977,986 (GRCm39) frame shift probably null
R7748:Bod1l UTSW 5 41,989,683 (GRCm39) missense probably damaging 0.97
R7767:Bod1l UTSW 5 41,974,099 (GRCm39) missense probably benign 0.01
R7773:Bod1l UTSW 5 41,990,055 (GRCm39) missense probably benign 0.14
R7782:Bod1l UTSW 5 41,975,286 (GRCm39) missense probably benign 0.01
R7860:Bod1l UTSW 5 41,976,608 (GRCm39) missense probably damaging 1.00
R7975:Bod1l UTSW 5 41,973,620 (GRCm39) missense possibly damaging 0.90
R7977:Bod1l UTSW 5 41,952,413 (GRCm39) missense probably damaging 1.00
R7987:Bod1l UTSW 5 41,952,413 (GRCm39) missense probably damaging 1.00
R8104:Bod1l UTSW 5 41,991,075 (GRCm39) nonsense probably null
R8217:Bod1l UTSW 5 41,988,850 (GRCm39) missense probably damaging 1.00
R8307:Bod1l UTSW 5 41,978,498 (GRCm39) missense probably damaging 1.00
R8469:Bod1l UTSW 5 41,978,834 (GRCm39) missense possibly damaging 0.86
R8506:Bod1l UTSW 5 41,976,398 (GRCm39) nonsense probably null
R8934:Bod1l UTSW 5 41,976,944 (GRCm39) missense probably benign 0.11
R8984:Bod1l UTSW 5 41,946,215 (GRCm39) missense probably damaging 1.00
R8989:Bod1l UTSW 5 41,979,025 (GRCm39) missense probably benign 0.00
R8993:Bod1l UTSW 5 41,974,210 (GRCm39) missense probably benign 0.01
R9128:Bod1l UTSW 5 41,946,266 (GRCm39) missense probably benign 0.22
R9129:Bod1l UTSW 5 41,976,220 (GRCm39) missense probably damaging 0.99
R9198:Bod1l UTSW 5 41,957,129 (GRCm39) missense probably benign 0.08
R9254:Bod1l UTSW 5 41,979,223 (GRCm39) missense probably damaging 1.00
R9445:Bod1l UTSW 5 41,974,619 (GRCm39) missense probably benign 0.04
R9470:Bod1l UTSW 5 41,974,439 (GRCm39) missense probably damaging 0.99
R9536:Bod1l UTSW 5 41,974,305 (GRCm39) missense probably benign 0.01
R9654:Bod1l UTSW 5 41,975,707 (GRCm39) missense probably benign 0.02
R9734:Bod1l UTSW 5 41,962,573 (GRCm39) missense possibly damaging 0.91
R9771:Bod1l UTSW 5 41,949,206 (GRCm39) missense probably damaging 0.96
X0027:Bod1l UTSW 5 41,990,012 (GRCm39) missense probably benign 0.20
X0058:Bod1l UTSW 5 41,981,361 (GRCm39) missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41,966,107 (GRCm39) missense possibly damaging 0.95
Z1088:Bod1l UTSW 5 41,978,489 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACTGTCACCTTTGTG -3'
(R):5'- AAAAGGCCTCTTCCAAGGAC -3'

Sequencing Primer
(F):5'- ACACTGTCACCTTTGTGTTTGTG -3'
(R):5'- TCTTCCAAGGACCTCAGGC -3'
Posted On 2022-06-15