Incidental Mutation 'R9457:Olfr606'
ID 714649
Institutional Source Beutler Lab
Gene Symbol Olfr606
Ensembl Gene ENSMUSG00000073949
Gene Name olfactory receptor 606
Synonyms MOR17-2, GA_x6K02T2PBJ9-6173009-6173968
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 103449046-103453531 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103451411 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 25 (F25I)
Ref Sequence ENSEMBL: ENSMUSP00000151177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098200] [ENSMUST00000214347] [ENSMUST00000214631] [ENSMUST00000217250]
AlphaFold Q8VGZ8
Predicted Effect probably benign
Transcript: ENSMUST00000098200
AA Change: F25I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095802
Gene: ENSMUSG00000073949
AA Change: F25I

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Pfam:7tm_4 33 312 7.1e-116 PFAM
Pfam:7TM_GPCR_Srsx 37 307 9e-8 PFAM
Pfam:7tm_1 43 294 7.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214347
Predicted Effect probably benign
Transcript: ENSMUST00000214631
AA Change: F25I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000217250
AA Change: F25I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,179,246 H181R probably benign Het
4930404N11Rik C A 10: 81,365,777 V4L probably benign Het
4930430A15Rik A T 2: 111,170,286 M196K unknown Het
4932415D10Rik A G 10: 82,286,739 V3479A probably benign Het
A930009A15Rik T C 10: 115,578,331 L54P unknown Het
Ablim3 A G 18: 61,845,849 S204P probably benign Het
Acadl A G 1: 66,853,241 V141A probably benign Het
Ace3 A G 11: 105,994,861 D31G probably benign Het
Adam11 T G 11: 102,769,898 V85G probably benign Het
Adarb1 A T 10: 77,322,148 M155K possibly damaging Het
Arhgap10 G A 8: 77,384,786 T376M probably benign Het
Bod1l G T 5: 41,821,967 T668K probably damaging Het
Ccdc87 A G 19: 4,841,631 E717G probably damaging Het
Cdh17 T A 4: 11,771,329 I37N probably damaging Het
Cfap99 T G 5: 34,301,397 F45L probably benign Het
Chsy1 C A 7: 66,172,400 H794Q probably benign Het
Clec4a3 G A 6: 122,954,086 V45I probably benign Het
Clic3 G A 2: 25,457,718 V32I probably benign Het
Clip2 A T 5: 134,502,730 D740E probably benign Het
Col5a2 C T 1: 45,386,844 V1062I probably benign Het
Col5a2 A G 1: 45,392,813 probably null Het
Cyp2j11 C T 4: 96,307,359 V367I probably damaging Het
Ddr1 C T 17: 35,682,758 A821T possibly damaging Het
Dna2 G A 10: 62,950,793 E107K probably benign Het
Eif3d A G 15: 77,959,694 V484A probably benign Het
Fgfr4 A G 13: 55,161,127 T354A probably benign Het
Fkbp6 T C 5: 135,349,632 D54G probably benign Het
Gm4787 T A 12: 81,379,246 E46V probably damaging Het
Gm47995 A G 1: 151,198,475 T10A possibly damaging Het
Gm498 T C 7: 143,883,976 V137A possibly damaging Het
Gnb1l T A 16: 18,540,995 I50N probably damaging Het
Gphb5 A T 12: 75,415,749 V22D probably damaging Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Hmces T C 6: 87,933,274 V222A possibly damaging Het
Kat14 T A 2: 144,373,782 D62E probably benign Het
Kcnmb2 T A 3: 32,181,869 V89E probably benign Het
Kif23 T A 9: 61,944,225 N63I probably benign Het
Lamc2 T C 1: 153,139,854 M578V probably benign Het
Ltbp2 A T 12: 84,789,153 C1335S probably benign Het
Lyst A G 13: 13,687,745 E2622G possibly damaging Het
Mctp1 A T 13: 76,384,674 H47L probably benign Het
Micalcl A G 7: 112,411,458 K618R probably damaging Het
Mllt6 T C 11: 97,665,760 I92T probably benign Het
Morc2a A G 11: 3,676,184 I223V probably benign Het
Msh3 A T 13: 92,345,086 I306N probably benign Het
Myo3b T A 2: 70,095,209 S35T probably benign Het
Nfkbiz A T 16: 55,813,984 V700E probably damaging Het
Oit3 T A 10: 59,441,683 M1L unknown Het
Olfr1048 A T 2: 86,236,472 I114K probably damaging Het
Olfr1231 A T 2: 89,302,731 I287N probably damaging Het
Peg3 T G 7: 6,707,999 D1408A probably damaging Het
Plaa A C 4: 94,586,883 S201R possibly damaging Het
Psmd5 A G 2: 34,854,326 S395P probably benign Het
Ralgapa2 T C 2: 146,334,554 I1701V probably damaging Het
Rnf32 G A 5: 29,206,186 A157T probably damaging Het
Rrad T A 8: 104,629,727 probably null Het
Samm50 T A 15: 84,207,841 L339Q probably damaging Het
Scin T C 12: 40,104,958 E212G possibly damaging Het
Scrib T C 15: 76,067,299 D146G probably damaging Het
Slc19a1 G A 10: 77,049,771 D502N probably benign Het
Slc4a4 T C 5: 89,214,573 S839P probably damaging Het
Slc4a8 A G 15: 100,806,260 D764G probably damaging Het
Slc6a19 G A 13: 73,681,765 A590V probably damaging Het
Slfn8 G T 11: 83,017,706 H4N probably benign Het
Smad9 T A 3: 54,789,335 F274I possibly damaging Het
Snx4 A G 16: 33,286,010 E271G probably benign Het
Thap4 G A 1: 93,750,306 R253* probably null Het
Tmem65 T A 15: 58,790,179 I144F Het
Tnrc6a G A 7: 123,179,735 R1223Q probably benign Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Trpm2 T C 10: 77,911,392 Y1424C possibly damaging Het
Trrap T A 5: 144,826,668 Y2457N probably damaging Het
Vmn1r7 A G 6: 57,024,523 S251P probably damaging Het
Vmn2r89 A T 14: 51,456,012 E273V probably damaging Het
Vps52 A G 17: 33,962,182 D466G probably damaging Het
Xirp2 T C 2: 67,515,632 V2739A probably benign Het
Zc3h4 C T 7: 16,434,750 S1003F unknown Het
Zyg11a A T 4: 108,217,905 H6Q probably damaging Het
Other mutations in Olfr606
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Olfr606 APN 7 103451795 missense probably damaging 1.00
IGL01608:Olfr606 APN 7 103451804 missense probably benign 0.00
IGL02251:Olfr606 APN 7 103451771 nonsense probably null
IGL02319:Olfr606 APN 7 103452267 missense probably benign 0.01
R0369:Olfr606 UTSW 7 103452216 missense probably damaging 1.00
R0480:Olfr606 UTSW 7 103451628 missense probably benign 0.07
R1759:Olfr606 UTSW 7 103452149 missense probably benign 0.11
R1858:Olfr606 UTSW 7 103452125 missense probably benign 0.16
R2156:Olfr606 UTSW 7 103452164 missense probably benign 0.01
R4226:Olfr606 UTSW 7 103451577 missense probably benign 0.31
R4422:Olfr606 UTSW 7 103452243 missense probably damaging 0.99
R5071:Olfr606 UTSW 7 103451410 missense probably benign
R5074:Olfr606 UTSW 7 103451410 missense probably benign
R5137:Olfr606 UTSW 7 103451712 missense probably damaging 1.00
R5137:Olfr606 UTSW 7 103451713 nonsense probably null
R8914:Olfr606 UTSW 7 103451883 missense probably damaging 1.00
X0018:Olfr606 UTSW 7 103451798 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGCACTAGAGTCTCCCTTGC -3'
(R):5'- TTCTCGGGAAATAGACCACAAC -3'

Sequencing Primer
(F):5'- AGAGTCTCCCTTGCTTACTTTTTC -3'
(R):5'- CCCTGAAAAGTGATACCATAGCAGG -3'
Posted On 2022-06-15