Incidental Mutation 'R9457:Mical2'
ID 714650
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Name microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms 4921517J23Rik, Ebitein1, 5330438E18Rik, Micalcl
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.242) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 111825063-112012313 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112010665 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 618 (K618R)
Ref Sequence ENSEMBL: ENSMUSP00000062443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051308] [ENSMUST00000106645]
AlphaFold Q8BML1
Q9D5U9
Predicted Effect probably damaging
Transcript: ENSMUST00000051308
AA Change: K618R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000062443
Gene: ENSMUSG00000030771
AA Change: K618R

DomainStartEndE-ValueType
low complexity region 6 34 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
DUF3585 526 668 6.86e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106645
AA Change: K618R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102256
Gene: ENSMUSG00000030771
AA Change: K618R

DomainStartEndE-ValueType
low complexity region 6 34 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
DUF3585 526 668 6.86e-56 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000215412
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik T C 10: 115,414,236 (GRCm39) L54P unknown Het
Ablim3 A G 18: 61,978,920 (GRCm39) S204P probably benign Het
Acadl A G 1: 66,892,400 (GRCm39) V141A probably benign Het
Ace3 A G 11: 105,885,687 (GRCm39) D31G probably benign Het
Acte1 T C 7: 143,437,713 (GRCm39) V137A possibly damaging Het
Adam11 T G 11: 102,660,724 (GRCm39) V85G probably benign Het
Adarb1 A T 10: 77,157,982 (GRCm39) M155K possibly damaging Het
Arhgap10 G A 8: 78,111,415 (GRCm39) T376M probably benign Het
Bod1l G T 5: 41,979,310 (GRCm39) T668K probably damaging Het
Ccdc87 A G 19: 4,891,659 (GRCm39) E717G probably damaging Het
Cdh17 T A 4: 11,771,329 (GRCm39) I37N probably damaging Het
Cfap99 T G 5: 34,458,741 (GRCm39) F45L probably benign Het
Chsy1 C A 7: 65,822,148 (GRCm39) H794Q probably benign Het
Clec4a3 G A 6: 122,931,045 (GRCm39) V45I probably benign Het
Clic3 G A 2: 25,347,730 (GRCm39) V32I probably benign Het
Clip2 A T 5: 134,531,584 (GRCm39) D740E probably benign Het
Col5a2 C T 1: 45,426,004 (GRCm39) V1062I probably benign Het
Col5a2 A G 1: 45,431,973 (GRCm39) probably null Het
Cyp2j11 C T 4: 96,195,596 (GRCm39) V367I probably damaging Het
Ddr1 C T 17: 35,993,650 (GRCm39) A821T possibly damaging Het
Dna2 G A 10: 62,786,572 (GRCm39) E107K probably benign Het
Eif3d A G 15: 77,843,894 (GRCm39) V484A probably benign Het
Fgfr4 A G 13: 55,308,940 (GRCm39) T354A probably benign Het
Fkbp6 T C 5: 135,378,486 (GRCm39) D54G probably benign Het
Gm4787 T A 12: 81,426,020 (GRCm39) E46V probably damaging Het
Gm47995 A G 1: 151,074,226 (GRCm39) T10A possibly damaging Het
Gnb1l T A 16: 18,359,745 (GRCm39) I50N probably damaging Het
Gphb5 A T 12: 75,462,523 (GRCm39) V22D probably damaging Het
Gstt4 C T 10: 75,650,959 (GRCm39) C221Y probably benign Het
Hmces T C 6: 87,910,256 (GRCm39) V222A possibly damaging Het
Kat14 T A 2: 144,215,702 (GRCm39) D62E probably benign Het
Kcnmb2 T A 3: 32,236,018 (GRCm39) V89E probably benign Het
Kif23 T A 9: 61,851,507 (GRCm39) N63I probably benign Het
Lamc2 T C 1: 153,015,600 (GRCm39) M578V probably benign Het
Ltbp2 A T 12: 84,835,927 (GRCm39) C1335S probably benign Het
Lyst A G 13: 13,862,330 (GRCm39) E2622G possibly damaging Het
Mctp1 A T 13: 76,532,793 (GRCm39) H47L probably benign Het
Mllt6 T C 11: 97,556,586 (GRCm39) I92T probably benign Het
Morc2a A G 11: 3,626,184 (GRCm39) I223V probably benign Het
Msh3 A T 13: 92,481,594 (GRCm39) I306N probably benign Het
Myo3b T A 2: 69,925,553 (GRCm39) S35T probably benign Het
Nfkbiz A T 16: 55,634,347 (GRCm39) V700E probably damaging Het
Oit3 T A 10: 59,277,505 (GRCm39) M1L unknown Het
Or4c1 A T 2: 89,133,075 (GRCm39) I287N probably damaging Het
Or51l14 T A 7: 103,100,618 (GRCm39) F25I probably benign Het
Or8k17 A T 2: 86,066,816 (GRCm39) I114K probably damaging Het
Peg3 T G 7: 6,710,998 (GRCm39) D1408A probably damaging Het
Plaa A C 4: 94,475,120 (GRCm39) S201R possibly damaging Het
Potefam1 A T 2: 111,000,631 (GRCm39) M196K unknown Het
Psmd5 A G 2: 34,744,338 (GRCm39) S395P probably benign Het
Ralgapa2 T C 2: 146,176,474 (GRCm39) I1701V probably damaging Het
Rmc1 A G 18: 12,312,303 (GRCm39) H181R probably benign Het
Rnf32 G A 5: 29,411,184 (GRCm39) A157T probably damaging Het
Rrad T A 8: 105,356,359 (GRCm39) probably null Het
Samm50 T A 15: 84,092,042 (GRCm39) L339Q probably damaging Het
Scin T C 12: 40,154,957 (GRCm39) E212G possibly damaging Het
Scrib T C 15: 75,939,148 (GRCm39) D146G probably damaging Het
Slc19a1 G A 10: 76,885,605 (GRCm39) D502N probably benign Het
Slc4a4 T C 5: 89,362,432 (GRCm39) S839P probably damaging Het
Slc4a8 A G 15: 100,704,141 (GRCm39) D764G probably damaging Het
Slc6a19 G A 13: 73,829,884 (GRCm39) A590V probably damaging Het
Slfn8 G T 11: 82,908,532 (GRCm39) H4N probably benign Het
Smad9 T A 3: 54,696,756 (GRCm39) F274I possibly damaging Het
Snx4 A G 16: 33,106,380 (GRCm39) E271G probably benign Het
Spata31h1 A G 10: 82,122,573 (GRCm39) V3479A probably benign Het
Tektip1 C A 10: 81,201,611 (GRCm39) V4L probably benign Het
Thap4 G A 1: 93,678,028 (GRCm39) R253* probably null Het
Tmem65 T A 15: 58,662,028 (GRCm39) I144F Het
Tnrc6a G A 7: 122,778,958 (GRCm39) R1223Q probably benign Het
Traf7 CA CAA 17: 24,746,737 (GRCm39) probably benign Het
Trpm2 T C 10: 77,747,226 (GRCm39) Y1424C possibly damaging Het
Trrap T A 5: 144,763,478 (GRCm39) Y2457N probably damaging Het
Vmn1r7 A G 6: 57,001,508 (GRCm39) S251P probably damaging Het
Vmn2r89 A T 14: 51,693,469 (GRCm39) E273V probably damaging Het
Vps52 A G 17: 34,181,156 (GRCm39) D466G probably damaging Het
Xirp2 T C 2: 67,345,976 (GRCm39) V2739A probably benign Het
Zc3h4 C T 7: 16,168,675 (GRCm39) S1003F unknown Het
Zyg11a A T 4: 108,075,102 (GRCm39) H6Q probably damaging Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Mical2 APN 7 111,981,352 (GRCm39) missense possibly damaging 0.94
IGL00886:Mical2 APN 7 111,914,279 (GRCm39) missense probably benign 0.00
IGL00934:Mical2 APN 7 111,948,610 (GRCm39) missense probably damaging 1.00
IGL00941:Mical2 APN 7 111,920,652 (GRCm39) splice site probably benign
IGL01020:Mical2 APN 7 111,914,283 (GRCm39) splice site probably benign
IGL01395:Mical2 APN 7 111,922,792 (GRCm39) missense probably damaging 1.00
IGL01658:Mical2 APN 7 111,914,205 (GRCm39) missense probably damaging 1.00
IGL01775:Mical2 APN 7 111,981,269 (GRCm39) missense possibly damaging 0.89
IGL02040:Mical2 APN 7 111,910,613 (GRCm39) missense probably damaging 1.00
IGL02051:Mical2 APN 7 111,980,597 (GRCm39) missense probably benign 0.30
IGL02388:Mical2 APN 7 111,934,620 (GRCm39) missense probably benign
IGL02551:Mical2 APN 7 111,923,197 (GRCm39) missense probably benign 0.01
IGL02578:Mical2 APN 7 111,950,580 (GRCm39) missense probably benign 0.05
IGL02751:Mical2 APN 7 111,931,243 (GRCm39) missense probably benign 0.11
IGL03114:Mical2 APN 7 111,996,764 (GRCm39) missense probably damaging 1.00
R0091:Mical2 UTSW 7 111,980,503 (GRCm39) missense probably benign 0.05
R0101:Mical2 UTSW 7 111,936,074 (GRCm39) missense possibly damaging 0.86
R0415:Mical2 UTSW 7 111,980,235 (GRCm39) missense probably damaging 1.00
R0504:Mical2 UTSW 7 111,870,524 (GRCm39) missense probably benign 0.00
R0594:Mical2 UTSW 7 111,917,657 (GRCm39) missense probably damaging 0.97
R0609:Mical2 UTSW 7 111,920,647 (GRCm39) splice site probably null
R0962:Mical2 UTSW 7 111,979,624 (GRCm39) missense probably damaging 0.99
R1521:Mical2 UTSW 7 111,980,817 (GRCm39) missense probably damaging 1.00
R1542:Mical2 UTSW 7 111,908,675 (GRCm39) missense probably damaging 1.00
R1611:Mical2 UTSW 7 111,980,671 (GRCm39) missense probably damaging 0.99
R1740:Mical2 UTSW 7 111,933,043 (GRCm39) missense probably benign
R1815:Mical2 UTSW 7 112,012,109 (GRCm39) missense probably damaging 1.00
R1855:Mical2 UTSW 7 111,944,489 (GRCm39) missense probably benign 0.21
R1958:Mical2 UTSW 7 111,980,311 (GRCm39) missense probably benign 0.00
R1962:Mical2 UTSW 7 112,012,051 (GRCm39) missense probably benign 0.14
R2086:Mical2 UTSW 7 111,917,810 (GRCm39) missense probably benign 0.31
R2136:Mical2 UTSW 7 111,870,722 (GRCm39) missense possibly damaging 0.72
R2418:Mical2 UTSW 7 111,919,941 (GRCm39) critical splice donor site probably null
R2439:Mical2 UTSW 7 111,994,002 (GRCm39) missense probably damaging 0.99
R3053:Mical2 UTSW 7 111,910,630 (GRCm39) missense probably damaging 1.00
R3979:Mical2 UTSW 7 112,006,885 (GRCm39) splice site probably null
R4308:Mical2 UTSW 7 111,931,199 (GRCm39) missense probably benign 0.27
R4551:Mical2 UTSW 7 111,981,123 (GRCm39) missense possibly damaging 0.87
R4583:Mical2 UTSW 7 112,012,154 (GRCm39) missense probably benign 0.02
R4663:Mical2 UTSW 7 111,927,884 (GRCm39) missense possibly damaging 0.80
R4868:Mical2 UTSW 7 111,917,831 (GRCm39) missense probably damaging 1.00
R4902:Mical2 UTSW 7 111,936,107 (GRCm39) missense probably benign
R5112:Mical2 UTSW 7 111,919,818 (GRCm39) missense probably damaging 1.00
R5459:Mical2 UTSW 7 111,981,444 (GRCm39) missense probably benign 0.00
R5487:Mical2 UTSW 7 111,919,842 (GRCm39) missense probably damaging 1.00
R5563:Mical2 UTSW 7 111,914,185 (GRCm39) missense probably damaging 1.00
R5763:Mical2 UTSW 7 111,973,861 (GRCm39) critical splice donor site probably null
R5817:Mical2 UTSW 7 111,922,866 (GRCm39) missense probably benign
R5987:Mical2 UTSW 7 111,934,155 (GRCm39) missense probably benign 0.00
R6042:Mical2 UTSW 7 111,979,619 (GRCm39) missense probably benign 0.40
R6087:Mical2 UTSW 7 111,917,692 (GRCm39) nonsense probably null
R6189:Mical2 UTSW 7 112,012,087 (GRCm39) missense probably damaging 1.00
R6209:Mical2 UTSW 7 111,923,293 (GRCm39) splice site probably null
R6311:Mical2 UTSW 7 111,922,765 (GRCm39) missense probably damaging 1.00
R6319:Mical2 UTSW 7 111,927,884 (GRCm39) missense possibly damaging 0.80
R6578:Mical2 UTSW 7 111,910,652 (GRCm39) missense probably damaging 1.00
R6750:Mical2 UTSW 7 111,981,046 (GRCm39) missense probably damaging 0.98
R6782:Mical2 UTSW 7 111,945,968 (GRCm39) missense probably damaging 1.00
R6798:Mical2 UTSW 7 111,975,266 (GRCm39) utr 3 prime probably benign
R7061:Mical2 UTSW 7 111,946,008 (GRCm39) missense probably benign 0.10
R7147:Mical2 UTSW 7 111,922,810 (GRCm39) missense possibly damaging 0.77
R7260:Mical2 UTSW 7 111,919,001 (GRCm39) missense probably benign 0.10
R7266:Mical2 UTSW 7 111,902,963 (GRCm39) missense probably damaging 1.00
R7347:Mical2 UTSW 7 111,981,358 (GRCm39) missense probably benign 0.01
R7391:Mical2 UTSW 7 111,919,816 (GRCm39) missense probably damaging 1.00
R7724:Mical2 UTSW 7 111,922,833 (GRCm39) missense probably damaging 1.00
R7747:Mical2 UTSW 7 111,933,046 (GRCm39) missense probably benign 0.02
R7783:Mical2 UTSW 7 112,012,183 (GRCm39) missense probably damaging 1.00
R7818:Mical2 UTSW 7 111,944,514 (GRCm39) missense probably damaging 1.00
R7824:Mical2 UTSW 7 112,006,844 (GRCm39) missense probably damaging 1.00
R7995:Mical2 UTSW 7 111,980,975 (GRCm39) missense probably benign 0.31
R8022:Mical2 UTSW 7 111,902,974 (GRCm39) missense probably damaging 1.00
R8429:Mical2 UTSW 7 111,944,460 (GRCm39) missense probably benign 0.01
R8505:Mical2 UTSW 7 111,919,007 (GRCm39) missense probably benign 0.02
R8532:Mical2 UTSW 7 111,917,751 (GRCm39) missense probably damaging 1.00
R8830:Mical2 UTSW 7 111,980,403 (GRCm39) missense probably benign 0.01
R8862:Mical2 UTSW 7 111,910,574 (GRCm39) missense probably damaging 1.00
R8906:Mical2 UTSW 7 111,980,671 (GRCm39) missense probably damaging 0.99
R8988:Mical2 UTSW 7 111,910,661 (GRCm39) missense possibly damaging 0.63
R9006:Mical2 UTSW 7 111,981,323 (GRCm39) missense probably benign 0.13
R9123:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9127:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9128:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9129:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9140:Mical2 UTSW 7 112,006,826 (GRCm39) missense probably damaging 1.00
R9187:Mical2 UTSW 7 111,902,797 (GRCm39) nonsense probably null
R9233:Mical2 UTSW 7 111,981,399 (GRCm39) missense probably benign 0.05
R9304:Mical2 UTSW 7 111,980,974 (GRCm39) missense probably damaging 0.97
R9310:Mical2 UTSW 7 111,950,920 (GRCm39) missense probably benign 0.45
R9377:Mical2 UTSW 7 111,981,246 (GRCm39) missense probably benign 0.10
R9399:Mical2 UTSW 7 111,946,082 (GRCm39) missense probably damaging 1.00
R9500:Mical2 UTSW 7 111,936,054 (GRCm39) critical splice acceptor site probably null
R9620:Mical2 UTSW 7 111,980,403 (GRCm39) missense probably benign 0.01
R9652:Mical2 UTSW 7 111,945,996 (GRCm39) missense probably damaging 1.00
R9657:Mical2 UTSW 7 111,921,806 (GRCm39) missense probably benign 0.37
R9756:Mical2 UTSW 7 111,902,928 (GRCm39) missense probably damaging 0.99
R9789:Mical2 UTSW 7 111,945,996 (GRCm39) missense probably damaging 1.00
RF008:Mical2 UTSW 7 111,922,833 (GRCm39) missense probably damaging 1.00
X0062:Mical2 UTSW 7 111,946,050 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCATCTTTCTGGGCAC -3'
(R):5'- ACTCTGGCTGGCCTGTATAC -3'

Sequencing Primer
(F):5'- GCAACAGTGGCAATACCTTCTATTAG -3'
(R):5'- GGCCTGAATTCAATTTCCAGG -3'
Posted On 2022-06-15