Incidental Mutation 'R9457:Slc19a1'
ID 714659
Institutional Source Beutler Lab
Gene Symbol Slc19a1
Ensembl Gene ENSMUSG00000001436
Gene Name solute carrier family 19 (folate transporter), member 1
Synonyms RFC1, RFC-1, reduced folate carrier
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 77032241-77061002 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 77049771 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 502 (D502N)
Ref Sequence ENSEMBL: ENSMUSP00000101050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072755] [ENSMUST00000081654] [ENSMUST00000105409] [ENSMUST00000105410] [ENSMUST00000136925] [ENSMUST00000144234]
AlphaFold P41438
Predicted Effect probably benign
Transcript: ENSMUST00000072755
SMART Domains Protein: ENSMUSP00000072538
Gene: ENSMUSG00000001435

DomainStartEndE-ValueType
Pfam:DUF959 16 218 6.8e-104 PFAM
low complexity region 295 307 N/A INTRINSIC
FRI 369 484 4.03e-47 SMART
TSPN 492 680 4.25e-72 SMART
LamG 541 679 2.17e-2 SMART
low complexity region 699 715 N/A INTRINSIC
low complexity region 719 734 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
Pfam:Collagen 820 881 5.5e-11 PFAM
low complexity region 921 942 N/A INTRINSIC
Pfam:Collagen 951 1008 6.1e-10 PFAM
Pfam:Collagen 988 1053 1.4e-8 PFAM
Pfam:Collagen 1060 1117 7.3e-10 PFAM
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1166 1181 N/A INTRINSIC
low complexity region 1186 1202 N/A INTRINSIC
Pfam:Collagen 1207 1267 8.2e-10 PFAM
low complexity region 1275 1288 N/A INTRINSIC
low complexity region 1301 1319 N/A INTRINSIC
low complexity region 1358 1393 N/A INTRINSIC
low complexity region 1397 1414 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1441 1454 N/A INTRINSIC
Pfam:Endostatin 1461 1769 4.4e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081654
SMART Domains Protein: ENSMUSP00000080358
Gene: ENSMUSG00000001435

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
TSPN 33 221 4.25e-72 SMART
LamG 82 220 2.17e-2 SMART
low complexity region 240 256 N/A INTRINSIC
low complexity region 260 275 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Pfam:Collagen 359 422 1.6e-10 PFAM
low complexity region 462 483 N/A INTRINSIC
Pfam:Collagen 492 549 1.6e-9 PFAM
Pfam:Collagen 529 594 3.3e-8 PFAM
Pfam:Collagen 601 658 1.9e-9 PFAM
Pfam:Collagen 631 689 4e-8 PFAM
Pfam:Collagen 701 752 1.7e-7 PFAM
Pfam:Collagen 748 808 2.2e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 842 860 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 938 955 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Pfam:Endostatin 999 1315 8.2e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105409
SMART Domains Protein: ENSMUSP00000101049
Gene: ENSMUSG00000001435

DomainStartEndE-ValueType
Pfam:DUF959 16 219 3.6e-100 PFAM
TSPN 245 433 4.25e-72 SMART
LamG 294 432 2.17e-2 SMART
low complexity region 452 468 N/A INTRINSIC
low complexity region 472 487 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 542 613 N/A INTRINSIC
low complexity region 630 648 N/A INTRINSIC
low complexity region 674 695 N/A INTRINSIC
Pfam:Collagen 700 761 5.4e-9 PFAM
Pfam:Collagen 741 806 4e-8 PFAM
Pfam:Collagen 813 874 2.1e-10 PFAM
Pfam:Collagen 846 901 1.2e-7 PFAM
Pfam:Collagen 913 964 2.1e-7 PFAM
Pfam:Collagen 960 1020 2.6e-9 PFAM
low complexity region 1028 1041 N/A INTRINSIC
low complexity region 1054 1072 N/A INTRINSIC
low complexity region 1111 1146 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1170 1186 N/A INTRINSIC
low complexity region 1194 1207 N/A INTRINSIC
Pfam:Endostatin 1211 1527 1.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105410
AA Change: D502N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101050
Gene: ENSMUSG00000001436
AA Change: D502N

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131031
SMART Domains Protein: ENSMUSP00000114884
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 1 112 1.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136925
SMART Domains Protein: ENSMUSP00000119382
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 426 7.8e-163 PFAM
Pfam:MFS_1 66 405 4.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144234
AA Change: D502N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116784
Gene: ENSMUSG00000001436
AA Change: D502N

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a transporter of folate and is involved in the regulation of intracellular concentrations of folate. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null embryos die due to abnormalities of hematopoietic organs. Mutant mice may be partially rescued with maternal folic acid supplementation, but these mice still present with hematopoietic organ defects and show impaired development of urogenital structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,179,246 H181R probably benign Het
4930404N11Rik C A 10: 81,365,777 V4L probably benign Het
4930430A15Rik A T 2: 111,170,286 M196K unknown Het
4932415D10Rik A G 10: 82,286,739 V3479A probably benign Het
A930009A15Rik T C 10: 115,578,331 L54P unknown Het
Ablim3 A G 18: 61,845,849 S204P probably benign Het
Acadl A G 1: 66,853,241 V141A probably benign Het
Ace3 A G 11: 105,994,861 D31G probably benign Het
Adam11 T G 11: 102,769,898 V85G probably benign Het
Adarb1 A T 10: 77,322,148 M155K possibly damaging Het
Arhgap10 G A 8: 77,384,786 T376M probably benign Het
Bod1l G T 5: 41,821,967 T668K probably damaging Het
Ccdc87 A G 19: 4,841,631 E717G probably damaging Het
Cdh17 T A 4: 11,771,329 I37N probably damaging Het
Cfap99 T G 5: 34,301,397 F45L probably benign Het
Chsy1 C A 7: 66,172,400 H794Q probably benign Het
Clec4a3 G A 6: 122,954,086 V45I probably benign Het
Clic3 G A 2: 25,457,718 V32I probably benign Het
Clip2 A T 5: 134,502,730 D740E probably benign Het
Col5a2 C T 1: 45,386,844 V1062I probably benign Het
Col5a2 A G 1: 45,392,813 probably null Het
Cyp2j11 C T 4: 96,307,359 V367I probably damaging Het
Ddr1 C T 17: 35,682,758 A821T possibly damaging Het
Dna2 G A 10: 62,950,793 E107K probably benign Het
Eif3d A G 15: 77,959,694 V484A probably benign Het
Fgfr4 A G 13: 55,161,127 T354A probably benign Het
Fkbp6 T C 5: 135,349,632 D54G probably benign Het
Gm4787 T A 12: 81,379,246 E46V probably damaging Het
Gm47995 A G 1: 151,198,475 T10A possibly damaging Het
Gm498 T C 7: 143,883,976 V137A possibly damaging Het
Gnb1l T A 16: 18,540,995 I50N probably damaging Het
Gphb5 A T 12: 75,415,749 V22D probably damaging Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Hmces T C 6: 87,933,274 V222A possibly damaging Het
Kat14 T A 2: 144,373,782 D62E probably benign Het
Kcnmb2 T A 3: 32,181,869 V89E probably benign Het
Kif23 T A 9: 61,944,225 N63I probably benign Het
Lamc2 T C 1: 153,139,854 M578V probably benign Het
Ltbp2 A T 12: 84,789,153 C1335S probably benign Het
Lyst A G 13: 13,687,745 E2622G possibly damaging Het
Mctp1 A T 13: 76,384,674 H47L probably benign Het
Micalcl A G 7: 112,411,458 K618R probably damaging Het
Mllt6 T C 11: 97,665,760 I92T probably benign Het
Morc2a A G 11: 3,676,184 I223V probably benign Het
Msh3 A T 13: 92,345,086 I306N probably benign Het
Myo3b T A 2: 70,095,209 S35T probably benign Het
Nfkbiz A T 16: 55,813,984 V700E probably damaging Het
Oit3 T A 10: 59,441,683 M1L unknown Het
Olfr1048 A T 2: 86,236,472 I114K probably damaging Het
Olfr1231 A T 2: 89,302,731 I287N probably damaging Het
Olfr606 T A 7: 103,451,411 F25I probably benign Het
Peg3 T G 7: 6,707,999 D1408A probably damaging Het
Plaa A C 4: 94,586,883 S201R possibly damaging Het
Psmd5 A G 2: 34,854,326 S395P probably benign Het
Ralgapa2 T C 2: 146,334,554 I1701V probably damaging Het
Rnf32 G A 5: 29,206,186 A157T probably damaging Het
Rrad T A 8: 104,629,727 probably null Het
Samm50 T A 15: 84,207,841 L339Q probably damaging Het
Scin T C 12: 40,104,958 E212G possibly damaging Het
Scrib T C 15: 76,067,299 D146G probably damaging Het
Slc4a4 T C 5: 89,214,573 S839P probably damaging Het
Slc4a8 A G 15: 100,806,260 D764G probably damaging Het
Slc6a19 G A 13: 73,681,765 A590V probably damaging Het
Slfn8 G T 11: 83,017,706 H4N probably benign Het
Smad9 T A 3: 54,789,335 F274I possibly damaging Het
Snx4 A G 16: 33,286,010 E271G probably benign Het
Thap4 G A 1: 93,750,306 R253* probably null Het
Tmem65 T A 15: 58,790,179 I144F Het
Tnrc6a G A 7: 123,179,735 R1223Q probably benign Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Trpm2 T C 10: 77,911,392 Y1424C possibly damaging Het
Trrap T A 5: 144,826,668 Y2457N probably damaging Het
Vmn1r7 A G 6: 57,024,523 S251P probably damaging Het
Vmn2r89 A T 14: 51,456,012 E273V probably damaging Het
Vps52 A G 17: 33,962,182 D466G probably damaging Het
Xirp2 T C 2: 67,515,632 V2739A probably benign Het
Zc3h4 C T 7: 16,434,750 S1003F unknown Het
Zyg11a A T 4: 108,217,905 H6Q probably damaging Het
Other mutations in Slc19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0112:Slc19a1 UTSW 10 77042165 missense probably benign 0.04
R0211:Slc19a1 UTSW 10 77038466 missense possibly damaging 0.92
R0419:Slc19a1 UTSW 10 77042908 missense probably damaging 1.00
R1459:Slc19a1 UTSW 10 77042535 nonsense probably null
R1725:Slc19a1 UTSW 10 77041838 missense probably benign 0.03
R2202:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2203:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2221:Slc19a1 UTSW 10 77042486 missense probably benign 0.00
R3861:Slc19a1 UTSW 10 77041975 missense possibly damaging 0.88
R3968:Slc19a1 UTSW 10 77041846 missense probably damaging 1.00
R5800:Slc19a1 UTSW 10 77042269 missense probably null 0.00
R6106:Slc19a1 UTSW 10 77044769 missense probably damaging 1.00
R6501:Slc19a1 UTSW 10 77049606 missense probably benign 0.11
R6992:Slc19a1 UTSW 10 77049706 missense possibly damaging 0.86
R7909:Slc19a1 UTSW 10 77049540 missense probably damaging 1.00
R8482:Slc19a1 UTSW 10 77049663 missense probably benign 0.00
R9081:Slc19a1 UTSW 10 77041916 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGCTGGATGGCTTAAGGTAC -3'
(R):5'- TTCTGTGGCCTAACCTAAAGG -3'

Sequencing Primer
(F):5'- ATGGCTTAAGGTACTGCCAGC -3'
(R):5'- CTCCTAAAAGGCAACAGCGGG -3'
Posted On 2022-06-15