Incidental Mutation 'R0767:Kiz'
ID71466
Institutional Source Beutler Lab
Gene Symbol Kiz
Ensembl Gene ENSMUSG00000074749
Gene Namekizuna centrosomal protein
SynonymsPlk1s1, LOC228730, Ncrna00153, Gm114
MMRRC Submission 038947-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0767 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location146855864-146970097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 146889051 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 154 (T154S)
Ref Sequence ENSEMBL: ENSMUSP00000096884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099278] [ENSMUST00000156232]
Predicted Effect probably damaging
Transcript: ENSMUST00000099278
AA Change: T154S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096884
Gene: ENSMUSG00000074749
AA Change: T154S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
coiled coil region 102 132 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 376 399 N/A INTRINSIC
low complexity region 632 646 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156232
AA Change: T127S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121952
Gene: ENSMUSG00000074749
AA Change: T127S

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 15 26 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes, strengthening and stabilizing the pericentriolar region prior to spindle formation. The encoded protein usually remains with the mother centrosome after centrosomal duplication. Sevral transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutants with truncated C-term transcript were normal size and weight, bred normally with normal litter size, and no obvious defects during fetal or adult development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 4 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Pfkp C T 13: 6,605,012 V344M probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Other mutations in Kiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Kiz APN 2 146863801 missense probably benign 0.22
IGL01649:Kiz APN 2 146889309 missense probably benign 0.35
IGL02184:Kiz APN 2 146889600 missense probably benign 0.20
IGL02500:Kiz APN 2 146863813 missense probably benign 0.06
IGL02548:Kiz APN 2 146870770 missense probably damaging 0.99
R0284:Kiz UTSW 2 146863810 missense probably benign 0.22
R0364:Kiz UTSW 2 146942156 missense probably benign 0.20
R0478:Kiz UTSW 2 146942158 missense possibly damaging 0.93
R0685:Kiz UTSW 2 146856058 splice site probably benign
R0866:Kiz UTSW 2 146856053 splice site probably benign
R1180:Kiz UTSW 2 146970007 missense unknown
R2037:Kiz UTSW 2 146969960 missense probably damaging 1.00
R2055:Kiz UTSW 2 146891283 missense probably benign 0.10
R2877:Kiz UTSW 2 146889556 missense possibly damaging 0.75
R4780:Kiz UTSW 2 146889246 missense possibly damaging 0.90
R4822:Kiz UTSW 2 146891069 missense probably damaging 1.00
R4835:Kiz UTSW 2 146942088 missense probably damaging 1.00
R5004:Kiz UTSW 2 146969979 missense possibly damaging 0.83
R5473:Kiz UTSW 2 146969995 nonsense probably null
R5878:Kiz UTSW 2 146889601 missense probably damaging 0.99
R6216:Kiz UTSW 2 146889497 missense probably damaging 1.00
R6222:Kiz UTSW 2 146891061 missense probably damaging 1.00
R7144:Kiz UTSW 2 146950510 splice site probably null
R7475:Kiz UTSW 2 146891086 missense possibly damaging 0.90
R7580:Kiz UTSW 2 146956249 missense probably damaging 0.99
R7848:Kiz UTSW 2 146889180 missense probably benign 0.19
R8395:Kiz UTSW 2 146953029 missense possibly damaging 0.79
R8513:Kiz UTSW 2 146870764 critical splice acceptor site probably null
RF021:Kiz UTSW 2 146870830 missense possibly damaging 0.74
Z1177:Kiz UTSW 2 146935827 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TAATCTGGACTGTAGCGGAGCTGG -3'
(R):5'- TTCTGAAGCTGCCATCATGGGGAC -3'

Sequencing Primer
(F):5'- CTGGCTAATTCATTAAGTGGGAG -3'
(R):5'- CTTCTCACCAGTCTGAAGAGATG -3'
Posted On2013-09-30