Mutagenetix > Incidental Mutation

Incidental Mutation 'R9457:Trpm2'

714661

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R9457 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77911392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1424 (Y1424C)

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105401
AA Change: Y1424C

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: Y1424C

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	A	G	18: 12,179,246	H181R	probably benign	Het
4930404N11Rik	C	A	10: 81,365,777	V4L	probably benign	Het
4930430A15Rik	A	T	2: 111,170,286	M196K	unknown	Het
4932415D10Rik	A	G	10: 82,286,739	V3479A	probably benign	Het
A930009A15Rik	T	C	10: 115,578,331	L54P	unknown	Het
Ablim3	A	G	18: 61,845,849	S204P	probably benign	Het
Acadl	A	G	1: 66,853,241	V141A	probably benign	Het
Ace3	A	G	11: 105,994,861	D31G	probably benign	Het
Adam11	T	G	11: 102,769,898	V85G	probably benign	Het
Adarb1	A	T	10: 77,322,148	M155K	possibly damaging	Het
Arhgap10	G	A	8: 77,384,786	T376M	probably benign	Het
Bod1l	G	T	5: 41,821,967	T668K	probably damaging	Het
Ccdc87	A	G	19: 4,841,631	E717G	probably damaging	Het
Cdh17	T	A	4: 11,771,329	I37N	probably damaging	Het
Cfap99	T	G	5: 34,301,397	F45L	probably benign	Het
Chsy1	C	A	7: 66,172,400	H794Q	probably benign	Het
Clec4a3	G	A	6: 122,954,086	V45I	probably benign	Het
Clic3	G	A	2: 25,457,718	V32I	probably benign	Het
Clip2	A	T	5: 134,502,730	D740E	probably benign	Het
Col5a2	C	T	1: 45,386,844	V1062I	probably benign	Het
Col5a2	A	G	1: 45,392,813		probably null	Het
Cyp2j11	C	T	4: 96,307,359	V367I	probably damaging	Het
Ddr1	C	T	17: 35,682,758	A821T	possibly damaging	Het
Dna2	G	A	10: 62,950,793	E107K	probably benign	Het
Eif3d	A	G	15: 77,959,694	V484A	probably benign	Het
Fgfr4	A	G	13: 55,161,127	T354A	probably benign	Het
Fkbp6	T	C	5: 135,349,632	D54G	probably benign	Het
Gm4787	T	A	12: 81,379,246	E46V	probably damaging	Het
Gm47995	A	G	1: 151,198,475	T10A	possibly damaging	Het
Gm498	T	C	7: 143,883,976	V137A	possibly damaging	Het
Gnb1l	T	A	16: 18,540,995	I50N	probably damaging	Het
Gphb5	A	T	12: 75,415,749	V22D	probably damaging	Het
Gstt4	C	T	10: 75,815,125	C221Y	probably benign	Het
Hmces	T	C	6: 87,933,274	V222A	possibly damaging	Het
Kat14	T	A	2: 144,373,782	D62E	probably benign	Het
Kcnmb2	T	A	3: 32,181,869	V89E	probably benign	Het
Kif23	T	A	9: 61,944,225	N63I	probably benign	Het
Lamc2	T	C	1: 153,139,854	M578V	probably benign	Het
Ltbp2	A	T	12: 84,789,153	C1335S	probably benign	Het
Lyst	A	G	13: 13,687,745	E2622G	possibly damaging	Het
Mctp1	A	T	13: 76,384,674	H47L	probably benign	Het
Micalcl	A	G	7: 112,411,458	K618R	probably damaging	Het
Mllt6	T	C	11: 97,665,760	I92T	probably benign	Het
Morc2a	A	G	11: 3,676,184	I223V	probably benign	Het
Msh3	A	T	13: 92,345,086	I306N	probably benign	Het
Myo3b	T	A	2: 70,095,209	S35T	probably benign	Het
Nfkbiz	A	T	16: 55,813,984	V700E	probably damaging	Het
Oit3	T	A	10: 59,441,683	M1L	unknown	Het
Olfr1048	A	T	2: 86,236,472	I114K	probably damaging	Het
Olfr1231	A	T	2: 89,302,731	I287N	probably damaging	Het
Olfr606	T	A	7: 103,451,411	F25I	probably benign	Het
Peg3	T	G	7: 6,707,999	D1408A	probably damaging	Het
Plaa	A	C	4: 94,586,883	S201R	possibly damaging	Het
Psmd5	A	G	2: 34,854,326	S395P	probably benign	Het
Ralgapa2	T	C	2: 146,334,554	I1701V	probably damaging	Het
Rnf32	G	A	5: 29,206,186	A157T	probably damaging	Het
Rrad	T	A	8: 104,629,727		probably null	Het
Samm50	T	A	15: 84,207,841	L339Q	probably damaging	Het
Scin	T	C	12: 40,104,958	E212G	possibly damaging	Het
Scrib	T	C	15: 76,067,299	D146G	probably damaging	Het
Slc19a1	G	A	10: 77,049,771	D502N	probably benign	Het
Slc4a4	T	C	5: 89,214,573	S839P	probably damaging	Het
Slc4a8	A	G	15: 100,806,260	D764G	probably damaging	Het
Slc6a19	G	A	13: 73,681,765	A590V	probably damaging	Het
Slfn8	G	T	11: 83,017,706	H4N	probably benign	Het
Smad9	T	A	3: 54,789,335	F274I	possibly damaging	Het
Snx4	A	G	16: 33,286,010	E271G	probably benign	Het
Thap4	G	A	1: 93,750,306	R253*	probably null	Het
Tmem65	T	A	15: 58,790,179	I144F		Het
Tnrc6a	G	A	7: 123,179,735	R1223Q	probably benign	Het
Traf7	CA	CAA	17: 24,527,763		probably benign	Het
Trrap	T	A	5: 144,826,668	Y2457N	probably damaging	Het
Vmn1r7	A	G	6: 57,024,523	S251P	probably damaging	Het
Vmn2r89	A	T	14: 51,456,012	E273V	probably damaging	Het
Vps52	A	G	17: 33,962,182	D466G	probably damaging	Het
Xirp2	T	C	2: 67,515,632	V2739A	probably benign	Het
Zc3h4	C	T	7: 16,434,750	S1003F	unknown	Het
Zyg11a	A	T	4: 108,217,905	H6Q	probably damaging	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77947897	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77936002	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77966025	nonsense	probably null
R8340:Trpm2	UTSW	10	77923624	nonsense	probably null
R8354:Trpm2	UTSW	10	77933649	missense	probably damaging	1.00
R8427:Trpm2	UTSW	10	77911402	missense	possibly damaging	0.93
R8445:Trpm2	UTSW	10	77910252	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77932294	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77929288	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77941180	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77942942	nonsense	probably null
R9319:Trpm2	UTSW	10	77949198	missense	probably damaging	1.00
R9381:Trpm2	UTSW	10	77911357	missense	possibly damaging	0.90
R9477:Trpm2	UTSW	10	77911390	missense	probably benign	0.12
R9547:Trpm2	UTSW	10	77912633	missense	probably benign	0.33
R9660:Trpm2	UTSW	10	77930555	missense	probably benign	0.00
R9663:Trpm2	UTSW	10	77920486	missense	probably benign	0.01
Z1177:Trpm2	UTSW	10	77937868	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGAAGTCCCTGAAACATGTCTG -3'
(R):5'- TGACTTGTGCCAGAGGTCAG -3'

Sequencing Primer
(F):5'- CTGAAACATGTCTGGAGCATTTCACC -3'
(R):5'- CATGTACTGGGGAGTCTCAAGC -3'

Posted On

2022-06-15