Incidental Mutation 'R9457:Spata31h1'
ID 714663
Institutional Source Beutler Lab
Gene Symbol Spata31h1
Ensembl Gene ENSMUSG00000044581
Gene Name SPATA31 subfamily H member 1
Synonyms 4932415D10Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 82117950-82152416 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82122573 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 3479 (V3479A)
Ref Sequence ENSEMBL: ENSMUSP00000151425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171401] [ENSMUST00000217661]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000171401
SMART Domains Protein: ENSMUSP00000126178
Gene: ENSMUSG00000044581

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 241 263 N/A INTRINSIC
low complexity region 387 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217661
AA Change: V3479A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik T C 10: 115,414,236 (GRCm39) L54P unknown Het
Ablim3 A G 18: 61,978,920 (GRCm39) S204P probably benign Het
Acadl A G 1: 66,892,400 (GRCm39) V141A probably benign Het
Ace3 A G 11: 105,885,687 (GRCm39) D31G probably benign Het
Acte1 T C 7: 143,437,713 (GRCm39) V137A possibly damaging Het
Adam11 T G 11: 102,660,724 (GRCm39) V85G probably benign Het
Adarb1 A T 10: 77,157,982 (GRCm39) M155K possibly damaging Het
Arhgap10 G A 8: 78,111,415 (GRCm39) T376M probably benign Het
Bod1l G T 5: 41,979,310 (GRCm39) T668K probably damaging Het
Ccdc87 A G 19: 4,891,659 (GRCm39) E717G probably damaging Het
Cdh17 T A 4: 11,771,329 (GRCm39) I37N probably damaging Het
Cfap99 T G 5: 34,458,741 (GRCm39) F45L probably benign Het
Chsy1 C A 7: 65,822,148 (GRCm39) H794Q probably benign Het
Clec4a3 G A 6: 122,931,045 (GRCm39) V45I probably benign Het
Clic3 G A 2: 25,347,730 (GRCm39) V32I probably benign Het
Clip2 A T 5: 134,531,584 (GRCm39) D740E probably benign Het
Col5a2 C T 1: 45,426,004 (GRCm39) V1062I probably benign Het
Col5a2 A G 1: 45,431,973 (GRCm39) probably null Het
Cyp2j11 C T 4: 96,195,596 (GRCm39) V367I probably damaging Het
Ddr1 C T 17: 35,993,650 (GRCm39) A821T possibly damaging Het
Dna2 G A 10: 62,786,572 (GRCm39) E107K probably benign Het
Eif3d A G 15: 77,843,894 (GRCm39) V484A probably benign Het
Fgfr4 A G 13: 55,308,940 (GRCm39) T354A probably benign Het
Fkbp6 T C 5: 135,378,486 (GRCm39) D54G probably benign Het
Gm4787 T A 12: 81,426,020 (GRCm39) E46V probably damaging Het
Gm47995 A G 1: 151,074,226 (GRCm39) T10A possibly damaging Het
Gnb1l T A 16: 18,359,745 (GRCm39) I50N probably damaging Het
Gphb5 A T 12: 75,462,523 (GRCm39) V22D probably damaging Het
Gstt4 C T 10: 75,650,959 (GRCm39) C221Y probably benign Het
Hmces T C 6: 87,910,256 (GRCm39) V222A possibly damaging Het
Kat14 T A 2: 144,215,702 (GRCm39) D62E probably benign Het
Kcnmb2 T A 3: 32,236,018 (GRCm39) V89E probably benign Het
Kif23 T A 9: 61,851,507 (GRCm39) N63I probably benign Het
Lamc2 T C 1: 153,015,600 (GRCm39) M578V probably benign Het
Ltbp2 A T 12: 84,835,927 (GRCm39) C1335S probably benign Het
Lyst A G 13: 13,862,330 (GRCm39) E2622G possibly damaging Het
Mctp1 A T 13: 76,532,793 (GRCm39) H47L probably benign Het
Mical2 A G 7: 112,010,665 (GRCm39) K618R probably damaging Het
Mllt6 T C 11: 97,556,586 (GRCm39) I92T probably benign Het
Morc2a A G 11: 3,626,184 (GRCm39) I223V probably benign Het
Msh3 A T 13: 92,481,594 (GRCm39) I306N probably benign Het
Myo3b T A 2: 69,925,553 (GRCm39) S35T probably benign Het
Nfkbiz A T 16: 55,634,347 (GRCm39) V700E probably damaging Het
Oit3 T A 10: 59,277,505 (GRCm39) M1L unknown Het
Or4c1 A T 2: 89,133,075 (GRCm39) I287N probably damaging Het
Or51l14 T A 7: 103,100,618 (GRCm39) F25I probably benign Het
Or8k17 A T 2: 86,066,816 (GRCm39) I114K probably damaging Het
Peg3 T G 7: 6,710,998 (GRCm39) D1408A probably damaging Het
Plaa A C 4: 94,475,120 (GRCm39) S201R possibly damaging Het
Potefam1 A T 2: 111,000,631 (GRCm39) M196K unknown Het
Psmd5 A G 2: 34,744,338 (GRCm39) S395P probably benign Het
Ralgapa2 T C 2: 146,176,474 (GRCm39) I1701V probably damaging Het
Rmc1 A G 18: 12,312,303 (GRCm39) H181R probably benign Het
Rnf32 G A 5: 29,411,184 (GRCm39) A157T probably damaging Het
Rrad T A 8: 105,356,359 (GRCm39) probably null Het
Samm50 T A 15: 84,092,042 (GRCm39) L339Q probably damaging Het
Scin T C 12: 40,154,957 (GRCm39) E212G possibly damaging Het
Scrib T C 15: 75,939,148 (GRCm39) D146G probably damaging Het
Slc19a1 G A 10: 76,885,605 (GRCm39) D502N probably benign Het
Slc4a4 T C 5: 89,362,432 (GRCm39) S839P probably damaging Het
Slc4a8 A G 15: 100,704,141 (GRCm39) D764G probably damaging Het
Slc6a19 G A 13: 73,829,884 (GRCm39) A590V probably damaging Het
Slfn8 G T 11: 82,908,532 (GRCm39) H4N probably benign Het
Smad9 T A 3: 54,696,756 (GRCm39) F274I possibly damaging Het
Snx4 A G 16: 33,106,380 (GRCm39) E271G probably benign Het
Tektip1 C A 10: 81,201,611 (GRCm39) V4L probably benign Het
Thap4 G A 1: 93,678,028 (GRCm39) R253* probably null Het
Tmem65 T A 15: 58,662,028 (GRCm39) I144F Het
Tnrc6a G A 7: 122,778,958 (GRCm39) R1223Q probably benign Het
Traf7 CA CAA 17: 24,746,737 (GRCm39) probably benign Het
Trpm2 T C 10: 77,747,226 (GRCm39) Y1424C possibly damaging Het
Trrap T A 5: 144,763,478 (GRCm39) Y2457N probably damaging Het
Vmn1r7 A G 6: 57,001,508 (GRCm39) S251P probably damaging Het
Vmn2r89 A T 14: 51,693,469 (GRCm39) E273V probably damaging Het
Vps52 A G 17: 34,181,156 (GRCm39) D466G probably damaging Het
Xirp2 T C 2: 67,345,976 (GRCm39) V2739A probably benign Het
Zc3h4 C T 7: 16,168,675 (GRCm39) S1003F unknown Het
Zyg11a A T 4: 108,075,102 (GRCm39) H6Q probably damaging Het
Other mutations in Spata31h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Spata31h1 APN 10 82,119,586 (GRCm39) missense probably benign 0.06
IGL01457:Spata31h1 APN 10 82,120,568 (GRCm39) missense probably damaging 1.00
IGL01540:Spata31h1 APN 10 82,120,016 (GRCm39) missense possibly damaging 0.87
IGL02693:Spata31h1 APN 10 82,121,092 (GRCm39) missense probably benign 0.06
IGL02867:Spata31h1 APN 10 82,119,654 (GRCm39) missense probably damaging 0.96
IGL02889:Spata31h1 APN 10 82,119,654 (GRCm39) missense probably damaging 0.96
IGL03080:Spata31h1 APN 10 82,119,816 (GRCm39) missense probably damaging 0.99
IGL03120:Spata31h1 APN 10 82,120,869 (GRCm39) missense possibly damaging 0.90
IGL03351:Spata31h1 APN 10 82,119,401 (GRCm39) utr 3 prime probably benign
FR4449:Spata31h1 UTSW 10 82,121,303 (GRCm39) frame shift probably null
FR4548:Spata31h1 UTSW 10 82,126,830 (GRCm39) small insertion probably benign
FR4737:Spata31h1 UTSW 10 82,121,303 (GRCm39) small deletion probably benign
PIT4480001:Spata31h1 UTSW 10 82,119,586 (GRCm39) missense probably benign 0.06
R0102:Spata31h1 UTSW 10 82,119,390 (GRCm39) missense probably damaging 1.00
R0312:Spata31h1 UTSW 10 82,120,203 (GRCm39) missense probably damaging 1.00
R1303:Spata31h1 UTSW 10 82,120,390 (GRCm39) missense possibly damaging 0.94
R2039:Spata31h1 UTSW 10 82,120,510 (GRCm39) missense probably damaging 1.00
R2356:Spata31h1 UTSW 10 82,119,789 (GRCm39) missense possibly damaging 0.94
R4740:Spata31h1 UTSW 10 82,119,481 (GRCm39) missense possibly damaging 0.50
R4857:Spata31h1 UTSW 10 82,119,682 (GRCm39) missense possibly damaging 0.61
R5017:Spata31h1 UTSW 10 82,132,510 (GRCm39) missense unknown
R5095:Spata31h1 UTSW 10 82,119,501 (GRCm39) missense probably damaging 1.00
R5209:Spata31h1 UTSW 10 82,119,652 (GRCm39) missense possibly damaging 0.84
R5388:Spata31h1 UTSW 10 82,119,561 (GRCm39) missense probably damaging 0.99
R5642:Spata31h1 UTSW 10 82,120,317 (GRCm39) missense probably damaging 1.00
R5646:Spata31h1 UTSW 10 82,119,610 (GRCm39) missense probably damaging 0.99
R6188:Spata31h1 UTSW 10 82,121,091 (GRCm39) missense probably damaging 0.96
R6215:Spata31h1 UTSW 10 82,126,946 (GRCm39) missense probably benign 0.07
R6252:Spata31h1 UTSW 10 82,119,588 (GRCm39) missense probably benign 0.30
R6275:Spata31h1 UTSW 10 82,121,202 (GRCm39) missense probably damaging 1.00
R6303:Spata31h1 UTSW 10 82,126,202 (GRCm39) missense possibly damaging 0.79
R6304:Spata31h1 UTSW 10 82,126,202 (GRCm39) missense possibly damaging 0.79
R6313:Spata31h1 UTSW 10 82,129,470 (GRCm39) missense probably benign 0.00
R6323:Spata31h1 UTSW 10 82,118,916 (GRCm39) missense probably benign 0.27
R6374:Spata31h1 UTSW 10 82,124,731 (GRCm39) unclassified probably benign
R6407:Spata31h1 UTSW 10 82,129,645 (GRCm39) missense probably benign 0.16
R6468:Spata31h1 UTSW 10 82,131,150 (GRCm39) missense probably benign 0.01
R6490:Spata31h1 UTSW 10 82,125,138 (GRCm39) missense possibly damaging 0.90
R6605:Spata31h1 UTSW 10 82,131,871 (GRCm39) missense probably benign 0.27
R6614:Spata31h1 UTSW 10 82,127,482 (GRCm39) missense probably benign 0.31
R6626:Spata31h1 UTSW 10 82,128,667 (GRCm39) missense probably benign 0.03
R6630:Spata31h1 UTSW 10 82,122,906 (GRCm39) missense possibly damaging 0.81
R6646:Spata31h1 UTSW 10 82,132,664 (GRCm39) missense unknown
R6723:Spata31h1 UTSW 10 82,125,657 (GRCm39) missense possibly damaging 0.50
R6751:Spata31h1 UTSW 10 82,119,331 (GRCm39) missense probably benign 0.06
R6850:Spata31h1 UTSW 10 82,128,888 (GRCm39) missense possibly damaging 0.68
R6944:Spata31h1 UTSW 10 82,132,056 (GRCm39) missense probably benign 0.03
R6957:Spata31h1 UTSW 10 82,129,620 (GRCm39) missense probably benign 0.03
R6988:Spata31h1 UTSW 10 82,127,733 (GRCm39) missense possibly damaging 0.79
R7069:Spata31h1 UTSW 10 82,125,777 (GRCm39) missense probably damaging 0.99
R7164:Spata31h1 UTSW 10 82,122,063 (GRCm39) missense probably damaging 1.00
R7175:Spata31h1 UTSW 10 82,122,583 (GRCm39) missense probably damaging 1.00
R7201:Spata31h1 UTSW 10 82,127,461 (GRCm39) missense probably benign 0.03
R7203:Spata31h1 UTSW 10 82,129,248 (GRCm39) missense probably benign 0.00
R7205:Spata31h1 UTSW 10 82,125,161 (GRCm39) missense probably benign 0.35
R7241:Spata31h1 UTSW 10 82,122,876 (GRCm39) missense probably benign 0.01
R7283:Spata31h1 UTSW 10 82,127,131 (GRCm39) missense possibly damaging 0.90
R7305:Spata31h1 UTSW 10 82,120,953 (GRCm39) missense probably benign 0.06
R7358:Spata31h1 UTSW 10 82,127,847 (GRCm39) missense possibly damaging 0.79
R7360:Spata31h1 UTSW 10 82,132,341 (GRCm39) missense unknown
R7362:Spata31h1 UTSW 10 82,128,831 (GRCm39) missense possibly damaging 0.79
R7385:Spata31h1 UTSW 10 82,123,729 (GRCm39) missense probably benign 0.05
R7385:Spata31h1 UTSW 10 82,123,571 (GRCm39) missense probably benign 0.03
R7472:Spata31h1 UTSW 10 82,119,421 (GRCm39) missense probably benign 0.03
R7493:Spata31h1 UTSW 10 82,152,264 (GRCm39) missense unknown
R7493:Spata31h1 UTSW 10 82,124,798 (GRCm39) nonsense probably null
R7498:Spata31h1 UTSW 10 82,127,113 (GRCm39) missense probably benign 0.03
R7512:Spata31h1 UTSW 10 82,128,469 (GRCm39) missense probably benign 0.31
R7560:Spata31h1 UTSW 10 82,120,449 (GRCm39) missense probably damaging 1.00
R7591:Spata31h1 UTSW 10 82,128,046 (GRCm39) missense probably benign 0.16
R7636:Spata31h1 UTSW 10 82,130,973 (GRCm39) missense probably benign 0.01
R7640:Spata31h1 UTSW 10 82,130,490 (GRCm39) missense probably damaging 0.99
R7709:Spata31h1 UTSW 10 82,126,366 (GRCm39) missense possibly damaging 0.81
R7790:Spata31h1 UTSW 10 82,123,329 (GRCm39) missense probably benign 0.06
R7875:Spata31h1 UTSW 10 82,123,456 (GRCm39) missense possibly damaging 0.79
R7878:Spata31h1 UTSW 10 82,119,856 (GRCm39) missense probably benign 0.04
R7899:Spata31h1 UTSW 10 82,118,731 (GRCm39) missense unknown
R7905:Spata31h1 UTSW 10 82,131,936 (GRCm39) missense probably benign 0.03
R7975:Spata31h1 UTSW 10 82,119,823 (GRCm39) missense possibly damaging 0.95
R7988:Spata31h1 UTSW 10 82,131,934 (GRCm39) missense probably benign 0.03
R8076:Spata31h1 UTSW 10 82,132,520 (GRCm39) nonsense probably null
R8144:Spata31h1 UTSW 10 82,130,433 (GRCm39) nonsense probably null
R8429:Spata31h1 UTSW 10 82,125,301 (GRCm39) missense possibly damaging 0.62
R8465:Spata31h1 UTSW 10 82,152,298 (GRCm39) missense possibly damaging 0.52
R8470:Spata31h1 UTSW 10 82,126,314 (GRCm39) missense probably damaging 1.00
R8509:Spata31h1 UTSW 10 82,126,950 (GRCm39) missense probably benign 0.01
R8515:Spata31h1 UTSW 10 82,124,436 (GRCm39) missense probably benign 0.00
R8672:Spata31h1 UTSW 10 82,127,726 (GRCm39) missense probably benign 0.01
R8700:Spata31h1 UTSW 10 82,127,859 (GRCm39) missense possibly damaging 0.84
R8827:Spata31h1 UTSW 10 82,129,617 (GRCm39) missense probably benign 0.07
R8872:Spata31h1 UTSW 10 82,128,619 (GRCm39) missense probably benign 0.07
R8875:Spata31h1 UTSW 10 82,123,476 (GRCm39) missense probably benign 0.16
R8884:Spata31h1 UTSW 10 82,119,486 (GRCm39) missense probably damaging 0.96
R8906:Spata31h1 UTSW 10 82,122,379 (GRCm39) missense probably benign 0.02
R8924:Spata31h1 UTSW 10 82,131,295 (GRCm39) missense probably benign 0.03
R8949:Spata31h1 UTSW 10 82,123,753 (GRCm39) missense probably benign 0.00
R8957:Spata31h1 UTSW 10 82,124,908 (GRCm39) missense probably benign 0.07
R9042:Spata31h1 UTSW 10 82,123,185 (GRCm39) missense probably benign 0.08
R9056:Spata31h1 UTSW 10 82,127,101 (GRCm39) missense probably benign 0.01
R9062:Spata31h1 UTSW 10 82,126,945 (GRCm39) missense probably benign 0.03
R9074:Spata31h1 UTSW 10 82,123,894 (GRCm39) missense possibly damaging 0.90
R9086:Spata31h1 UTSW 10 82,124,577 (GRCm39) missense probably benign 0.07
R9113:Spata31h1 UTSW 10 82,131,352 (GRCm39) nonsense probably null
R9119:Spata31h1 UTSW 10 82,131,553 (GRCm39) missense probably benign 0.03
R9132:Spata31h1 UTSW 10 82,127,896 (GRCm39) missense possibly damaging 0.85
R9141:Spata31h1 UTSW 10 82,126,610 (GRCm39) missense probably damaging 0.98
R9151:Spata31h1 UTSW 10 82,120,928 (GRCm39) missense probably damaging 0.99
R9155:Spata31h1 UTSW 10 82,120,203 (GRCm39) missense probably damaging 1.00
R9159:Spata31h1 UTSW 10 82,118,524 (GRCm39) nonsense probably null
R9197:Spata31h1 UTSW 10 82,120,401 (GRCm39) missense possibly damaging 0.88
R9212:Spata31h1 UTSW 10 82,118,979 (GRCm39) missense possibly damaging 0.88
R9245:Spata31h1 UTSW 10 82,123,554 (GRCm39) missense probably benign 0.10
R9304:Spata31h1 UTSW 10 82,131,930 (GRCm39) missense probably benign 0.07
R9309:Spata31h1 UTSW 10 82,130,986 (GRCm39) missense probably benign 0.00
R9329:Spata31h1 UTSW 10 82,121,439 (GRCm39) missense probably benign 0.06
R9356:Spata31h1 UTSW 10 82,125,157 (GRCm39) missense possibly damaging 0.54
R9423:Spata31h1 UTSW 10 82,123,459 (GRCm39) missense possibly damaging 0.62
R9426:Spata31h1 UTSW 10 82,126,610 (GRCm39) missense probably damaging 0.98
R9509:Spata31h1 UTSW 10 82,132,229 (GRCm39) missense probably benign 0.03
R9612:Spata31h1 UTSW 10 82,125,453 (GRCm39) missense possibly damaging 0.55
R9674:Spata31h1 UTSW 10 82,120,030 (GRCm39) missense possibly damaging 0.69
R9726:Spata31h1 UTSW 10 82,118,605 (GRCm39) missense unknown
RF017:Spata31h1 UTSW 10 82,126,826 (GRCm39) small insertion probably benign
RF055:Spata31h1 UTSW 10 82,126,827 (GRCm39) small insertion probably benign
Z1176:Spata31h1 UTSW 10 82,129,062 (GRCm39) missense probably benign 0.03
Z1176:Spata31h1 UTSW 10 82,125,730 (GRCm39) missense possibly damaging 0.94
Z1176:Spata31h1 UTSW 10 82,118,371 (GRCm39) missense unknown
Z1177:Spata31h1 UTSW 10 82,123,251 (GRCm39) missense probably damaging 0.99
Z1177:Spata31h1 UTSW 10 82,122,960 (GRCm39) missense possibly damaging 0.85
Z1177:Spata31h1 UTSW 10 82,121,632 (GRCm39) missense possibly damaging 0.46
Z1177:Spata31h1 UTSW 10 82,125,520 (GRCm39) nonsense probably null
Z1187:Spata31h1 UTSW 10 82,124,390 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGGGATGTGACAGGATGTCC -3'
(R):5'- TTGATCTGACTCCAACACTAAGTG -3'

Sequencing Primer
(F):5'- GTGTTGATACTACAGATTGTTCCC -3'
(R):5'- TCTGACTCCAACACTAAGTGATCAAG -3'
Posted On 2022-06-15