Incidental Mutation 'R9457:4932415D10Rik'
ID 714663
Institutional Source Beutler Lab
Gene Symbol 4932415D10Rik
Ensembl Gene ENSMUSG00000044581
Gene Name RIKEN cDNA 4932415D10 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 82282116-82316582 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82286739 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 3479 (V3479A)
Ref Sequence ENSEMBL: ENSMUSP00000151425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171401] [ENSMUST00000217661]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000171401
SMART Domains Protein: ENSMUSP00000126178
Gene: ENSMUSG00000044581

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 241 263 N/A INTRINSIC
low complexity region 387 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217661
AA Change: V3479A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,179,246 H181R probably benign Het
4930404N11Rik C A 10: 81,365,777 V4L probably benign Het
4930430A15Rik A T 2: 111,170,286 M196K unknown Het
A930009A15Rik T C 10: 115,578,331 L54P unknown Het
Ablim3 A G 18: 61,845,849 S204P probably benign Het
Acadl A G 1: 66,853,241 V141A probably benign Het
Ace3 A G 11: 105,994,861 D31G probably benign Het
Adam11 T G 11: 102,769,898 V85G probably benign Het
Adarb1 A T 10: 77,322,148 M155K possibly damaging Het
Arhgap10 G A 8: 77,384,786 T376M probably benign Het
Bod1l G T 5: 41,821,967 T668K probably damaging Het
Ccdc87 A G 19: 4,841,631 E717G probably damaging Het
Cdh17 T A 4: 11,771,329 I37N probably damaging Het
Cfap99 T G 5: 34,301,397 F45L probably benign Het
Chsy1 C A 7: 66,172,400 H794Q probably benign Het
Clec4a3 G A 6: 122,954,086 V45I probably benign Het
Clic3 G A 2: 25,457,718 V32I probably benign Het
Clip2 A T 5: 134,502,730 D740E probably benign Het
Col5a2 C T 1: 45,386,844 V1062I probably benign Het
Col5a2 A G 1: 45,392,813 probably null Het
Cyp2j11 C T 4: 96,307,359 V367I probably damaging Het
Ddr1 C T 17: 35,682,758 A821T possibly damaging Het
Dna2 G A 10: 62,950,793 E107K probably benign Het
Eif3d A G 15: 77,959,694 V484A probably benign Het
Fgfr4 A G 13: 55,161,127 T354A probably benign Het
Fkbp6 T C 5: 135,349,632 D54G probably benign Het
Gm4787 T A 12: 81,379,246 E46V probably damaging Het
Gm47995 A G 1: 151,198,475 T10A possibly damaging Het
Gm498 T C 7: 143,883,976 V137A possibly damaging Het
Gnb1l T A 16: 18,540,995 I50N probably damaging Het
Gphb5 A T 12: 75,415,749 V22D probably damaging Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Hmces T C 6: 87,933,274 V222A possibly damaging Het
Kat14 T A 2: 144,373,782 D62E probably benign Het
Kcnmb2 T A 3: 32,181,869 V89E probably benign Het
Kif23 T A 9: 61,944,225 N63I probably benign Het
Lamc2 T C 1: 153,139,854 M578V probably benign Het
Ltbp2 A T 12: 84,789,153 C1335S probably benign Het
Lyst A G 13: 13,687,745 E2622G possibly damaging Het
Mctp1 A T 13: 76,384,674 H47L probably benign Het
Micalcl A G 7: 112,411,458 K618R probably damaging Het
Mllt6 T C 11: 97,665,760 I92T probably benign Het
Morc2a A G 11: 3,676,184 I223V probably benign Het
Msh3 A T 13: 92,345,086 I306N probably benign Het
Myo3b T A 2: 70,095,209 S35T probably benign Het
Nfkbiz A T 16: 55,813,984 V700E probably damaging Het
Oit3 T A 10: 59,441,683 M1L unknown Het
Olfr1048 A T 2: 86,236,472 I114K probably damaging Het
Olfr1231 A T 2: 89,302,731 I287N probably damaging Het
Olfr606 T A 7: 103,451,411 F25I probably benign Het
Peg3 T G 7: 6,707,999 D1408A probably damaging Het
Plaa A C 4: 94,586,883 S201R possibly damaging Het
Psmd5 A G 2: 34,854,326 S395P probably benign Het
Ralgapa2 T C 2: 146,334,554 I1701V probably damaging Het
Rnf32 G A 5: 29,206,186 A157T probably damaging Het
Rrad T A 8: 104,629,727 probably null Het
Samm50 T A 15: 84,207,841 L339Q probably damaging Het
Scin T C 12: 40,104,958 E212G possibly damaging Het
Scrib T C 15: 76,067,299 D146G probably damaging Het
Slc19a1 G A 10: 77,049,771 D502N probably benign Het
Slc4a4 T C 5: 89,214,573 S839P probably damaging Het
Slc4a8 A G 15: 100,806,260 D764G probably damaging Het
Slc6a19 G A 13: 73,681,765 A590V probably damaging Het
Slfn8 G T 11: 83,017,706 H4N probably benign Het
Smad9 T A 3: 54,789,335 F274I possibly damaging Het
Snx4 A G 16: 33,286,010 E271G probably benign Het
Thap4 G A 1: 93,750,306 R253* probably null Het
Tmem65 T A 15: 58,790,179 I144F Het
Tnrc6a G A 7: 123,179,735 R1223Q probably benign Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Trpm2 T C 10: 77,911,392 Y1424C possibly damaging Het
Trrap T A 5: 144,826,668 Y2457N probably damaging Het
Vmn1r7 A G 6: 57,024,523 S251P probably damaging Het
Vmn2r89 A T 14: 51,456,012 E273V probably damaging Het
Vps52 A G 17: 33,962,182 D466G probably damaging Het
Xirp2 T C 2: 67,515,632 V2739A probably benign Het
Zc3h4 C T 7: 16,434,750 S1003F unknown Het
Zyg11a A T 4: 108,217,905 H6Q probably damaging Het
Other mutations in 4932415D10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:4932415D10Rik APN 10 82283752 missense probably benign 0.06
IGL01457:4932415D10Rik APN 10 82284734 missense probably damaging 1.00
IGL01540:4932415D10Rik APN 10 82284182 missense possibly damaging 0.87
IGL02693:4932415D10Rik APN 10 82285258 missense probably benign 0.06
IGL02867:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL02889:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL03080:4932415D10Rik APN 10 82283982 missense probably damaging 0.99
IGL03120:4932415D10Rik APN 10 82285035 missense possibly damaging 0.90
IGL03351:4932415D10Rik APN 10 82283567 utr 3 prime probably benign
FR4449:4932415D10Rik UTSW 10 82285469 frame shift probably null
FR4548:4932415D10Rik UTSW 10 82290996 small insertion probably benign
FR4737:4932415D10Rik UTSW 10 82285469 small deletion probably benign
PIT4480001:4932415D10Rik UTSW 10 82283752 missense probably benign 0.06
R0102:4932415D10Rik UTSW 10 82283556 missense probably damaging 1.00
R0312:4932415D10Rik UTSW 10 82284369 missense probably damaging 1.00
R1303:4932415D10Rik UTSW 10 82284556 missense possibly damaging 0.94
R2039:4932415D10Rik UTSW 10 82284676 missense probably damaging 1.00
R2356:4932415D10Rik UTSW 10 82283955 missense possibly damaging 0.94
R4740:4932415D10Rik UTSW 10 82283647 missense possibly damaging 0.50
R4857:4932415D10Rik UTSW 10 82283848 missense possibly damaging 0.61
R5017:4932415D10Rik UTSW 10 82296676 missense unknown
R5095:4932415D10Rik UTSW 10 82283667 missense probably damaging 1.00
R5209:4932415D10Rik UTSW 10 82283818 missense possibly damaging 0.84
R5388:4932415D10Rik UTSW 10 82283727 missense probably damaging 0.99
R5642:4932415D10Rik UTSW 10 82284483 missense probably damaging 1.00
R5646:4932415D10Rik UTSW 10 82283776 missense probably damaging 0.99
R6188:4932415D10Rik UTSW 10 82285257 missense probably damaging 0.96
R6215:4932415D10Rik UTSW 10 82291112 missense probably benign 0.07
R6252:4932415D10Rik UTSW 10 82283754 missense probably benign 0.30
R6275:4932415D10Rik UTSW 10 82285368 missense probably damaging 1.00
R6303:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6304:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6313:4932415D10Rik UTSW 10 82293636 missense probably benign 0.00
R6323:4932415D10Rik UTSW 10 82283082 missense probably benign 0.27
R6374:4932415D10Rik UTSW 10 82288897 unclassified probably benign
R6407:4932415D10Rik UTSW 10 82293811 missense probably benign 0.16
R6468:4932415D10Rik UTSW 10 82295316 missense probably benign 0.01
R6490:4932415D10Rik UTSW 10 82289304 missense possibly damaging 0.90
R6605:4932415D10Rik UTSW 10 82296037 missense probably benign 0.27
R6614:4932415D10Rik UTSW 10 82291648 missense probably benign 0.31
R6626:4932415D10Rik UTSW 10 82292833 missense probably benign 0.03
R6630:4932415D10Rik UTSW 10 82287072 missense possibly damaging 0.81
R6646:4932415D10Rik UTSW 10 82296830 missense unknown
R6723:4932415D10Rik UTSW 10 82289823 missense possibly damaging 0.50
R6751:4932415D10Rik UTSW 10 82283497 missense probably benign 0.06
R6850:4932415D10Rik UTSW 10 82293054 missense possibly damaging 0.68
R6944:4932415D10Rik UTSW 10 82296222 missense probably benign 0.03
R6957:4932415D10Rik UTSW 10 82293786 missense probably benign 0.03
R6988:4932415D10Rik UTSW 10 82291899 missense possibly damaging 0.79
R7069:4932415D10Rik UTSW 10 82289943 missense probably damaging 0.99
R7164:4932415D10Rik UTSW 10 82286229 missense probably damaging 1.00
R7175:4932415D10Rik UTSW 10 82286749 missense probably damaging 1.00
R7201:4932415D10Rik UTSW 10 82291627 missense probably benign 0.03
R7203:4932415D10Rik UTSW 10 82293414 missense probably benign 0.00
R7205:4932415D10Rik UTSW 10 82289327 missense probably benign 0.35
R7241:4932415D10Rik UTSW 10 82287042 missense probably benign 0.01
R7283:4932415D10Rik UTSW 10 82291297 missense possibly damaging 0.90
R7305:4932415D10Rik UTSW 10 82285119 missense probably benign 0.06
R7358:4932415D10Rik UTSW 10 82292013 missense possibly damaging 0.79
R7360:4932415D10Rik UTSW 10 82296507 missense unknown
R7362:4932415D10Rik UTSW 10 82292997 missense possibly damaging 0.79
R7385:4932415D10Rik UTSW 10 82287737 missense probably benign 0.03
R7385:4932415D10Rik UTSW 10 82287895 missense probably benign 0.05
R7472:4932415D10Rik UTSW 10 82283587 missense probably benign 0.03
R7493:4932415D10Rik UTSW 10 82288964 nonsense probably null
R7493:4932415D10Rik UTSW 10 82316430 missense unknown
R7498:4932415D10Rik UTSW 10 82291279 missense probably benign 0.03
R7512:4932415D10Rik UTSW 10 82292635 missense probably benign 0.31
R7560:4932415D10Rik UTSW 10 82284615 missense probably damaging 1.00
R7591:4932415D10Rik UTSW 10 82292212 missense probably benign 0.16
R7636:4932415D10Rik UTSW 10 82295139 missense probably benign 0.01
R7640:4932415D10Rik UTSW 10 82294656 missense probably damaging 0.99
R7709:4932415D10Rik UTSW 10 82290532 missense possibly damaging 0.81
R7790:4932415D10Rik UTSW 10 82287495 missense probably benign 0.06
R7875:4932415D10Rik UTSW 10 82287622 missense possibly damaging 0.79
R7878:4932415D10Rik UTSW 10 82284022 missense probably benign 0.04
R7899:4932415D10Rik UTSW 10 82282897 missense unknown
R7905:4932415D10Rik UTSW 10 82296102 missense probably benign 0.03
R7975:4932415D10Rik UTSW 10 82283989 missense possibly damaging 0.95
R7988:4932415D10Rik UTSW 10 82296100 missense probably benign 0.03
R8076:4932415D10Rik UTSW 10 82296686 nonsense probably null
R8144:4932415D10Rik UTSW 10 82294599 nonsense probably null
R8429:4932415D10Rik UTSW 10 82289467 missense possibly damaging 0.62
R8465:4932415D10Rik UTSW 10 82316464 missense possibly damaging 0.52
R8470:4932415D10Rik UTSW 10 82290480 missense probably damaging 1.00
R8509:4932415D10Rik UTSW 10 82291116 missense probably benign 0.01
R8515:4932415D10Rik UTSW 10 82288602 missense probably benign 0.00
R8672:4932415D10Rik UTSW 10 82291892 missense probably benign 0.01
R8700:4932415D10Rik UTSW 10 82292025 missense possibly damaging 0.84
R8827:4932415D10Rik UTSW 10 82293783 missense probably benign 0.07
R8872:4932415D10Rik UTSW 10 82292785 missense probably benign 0.07
R8875:4932415D10Rik UTSW 10 82287642 missense probably benign 0.16
R8884:4932415D10Rik UTSW 10 82283652 missense probably damaging 0.96
R8906:4932415D10Rik UTSW 10 82286545 missense probably benign 0.02
R8924:4932415D10Rik UTSW 10 82295461 missense probably benign 0.03
R8949:4932415D10Rik UTSW 10 82287919 missense probably benign 0.00
R8957:4932415D10Rik UTSW 10 82289074 missense probably benign 0.07
R9042:4932415D10Rik UTSW 10 82287351 missense probably benign 0.08
R9056:4932415D10Rik UTSW 10 82291267 missense probably benign 0.01
R9062:4932415D10Rik UTSW 10 82291111 missense probably benign 0.03
R9074:4932415D10Rik UTSW 10 82288060 missense possibly damaging 0.90
R9086:4932415D10Rik UTSW 10 82288743 missense probably benign 0.07
R9113:4932415D10Rik UTSW 10 82295518 nonsense probably null
R9119:4932415D10Rik UTSW 10 82295719 missense probably benign 0.03
R9132:4932415D10Rik UTSW 10 82292062 missense possibly damaging 0.85
R9141:4932415D10Rik UTSW 10 82290776 missense probably damaging 0.98
R9151:4932415D10Rik UTSW 10 82285094 missense probably damaging 0.99
R9155:4932415D10Rik UTSW 10 82284369 missense probably damaging 1.00
R9159:4932415D10Rik UTSW 10 82282690 nonsense probably null
R9197:4932415D10Rik UTSW 10 82284567 missense possibly damaging 0.88
R9212:4932415D10Rik UTSW 10 82283145 missense possibly damaging 0.88
R9245:4932415D10Rik UTSW 10 82287720 missense probably benign 0.10
R9304:4932415D10Rik UTSW 10 82296096 missense probably benign 0.07
R9309:4932415D10Rik UTSW 10 82295152 missense probably benign 0.00
R9329:4932415D10Rik UTSW 10 82285605 missense probably benign 0.06
R9356:4932415D10Rik UTSW 10 82289323 missense possibly damaging 0.54
R9423:4932415D10Rik UTSW 10 82287625 missense possibly damaging 0.62
R9426:4932415D10Rik UTSW 10 82290776 missense probably damaging 0.98
R9509:4932415D10Rik UTSW 10 82296395 missense probably benign 0.03
R9612:4932415D10Rik UTSW 10 82289619 missense possibly damaging 0.55
R9674:4932415D10Rik UTSW 10 82284196 missense possibly damaging 0.69
R9726:4932415D10Rik UTSW 10 82282771 missense unknown
RF017:4932415D10Rik UTSW 10 82290992 small insertion probably benign
RF055:4932415D10Rik UTSW 10 82290993 small insertion probably benign
Z1176:4932415D10Rik UTSW 10 82282537 missense unknown
Z1176:4932415D10Rik UTSW 10 82289896 missense possibly damaging 0.94
Z1176:4932415D10Rik UTSW 10 82293228 missense probably benign 0.03
Z1177:4932415D10Rik UTSW 10 82285798 missense possibly damaging 0.46
Z1177:4932415D10Rik UTSW 10 82287126 missense possibly damaging 0.85
Z1177:4932415D10Rik UTSW 10 82287417 missense probably damaging 0.99
Z1177:4932415D10Rik UTSW 10 82289686 nonsense probably null
Z1187:4932415D10Rik UTSW 10 82288556 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGGGATGTGACAGGATGTCC -3'
(R):5'- TTGATCTGACTCCAACACTAAGTG -3'

Sequencing Primer
(F):5'- GTGTTGATACTACAGATTGTTCCC -3'
(R):5'- TCTGACTCCAACACTAAGTGATCAAG -3'
Posted On 2022-06-15