Incidental Mutation 'R9457:Mllt6'
ID 714667
Institutional Source Beutler Lab
Gene Symbol Mllt6
Ensembl Gene ENSMUSG00000038437
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms Af17
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 97663414-97685463 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97665760 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 92 (I92T)
Ref Sequence ENSEMBL: ENSMUSP00000045445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044730] [ENSMUST00000107586]
AlphaFold B1AR10
Predicted Effect probably benign
Transcript: ENSMUST00000044730
AA Change: I92T

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045445
Gene: ENSMUSG00000038437
AA Change: I92T

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 520 536 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
coiled coil region 703 744 N/A INTRINSIC
low complexity region 746 756 N/A INTRINSIC
low complexity region 773 782 N/A INTRINSIC
low complexity region 802 848 N/A INTRINSIC
low complexity region 860 901 N/A INTRINSIC
coiled coil region 915 942 N/A INTRINSIC
low complexity region 995 1018 N/A INTRINSIC
low complexity region 1026 1037 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107586
AA Change: I92T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103212
Gene: ENSMUSG00000038437
AA Change: I92T

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 336 356 N/A INTRINSIC
low complexity region 388 410 N/A INTRINSIC
low complexity region 428 442 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
low complexity region 532 546 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 609 631 N/A INTRINSIC
low complexity region 679 696 N/A INTRINSIC
coiled coil region 733 774 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
low complexity region 803 812 N/A INTRINSIC
low complexity region 832 878 N/A INTRINSIC
low complexity region 890 931 N/A INTRINSIC
coiled coil region 945 972 N/A INTRINSIC
low complexity region 1025 1048 N/A INTRINSIC
low complexity region 1056 1067 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,179,246 H181R probably benign Het
4930404N11Rik C A 10: 81,365,777 V4L probably benign Het
4930430A15Rik A T 2: 111,170,286 M196K unknown Het
4932415D10Rik A G 10: 82,286,739 V3479A probably benign Het
A930009A15Rik T C 10: 115,578,331 L54P unknown Het
Ablim3 A G 18: 61,845,849 S204P probably benign Het
Acadl A G 1: 66,853,241 V141A probably benign Het
Ace3 A G 11: 105,994,861 D31G probably benign Het
Adam11 T G 11: 102,769,898 V85G probably benign Het
Adarb1 A T 10: 77,322,148 M155K possibly damaging Het
Arhgap10 G A 8: 77,384,786 T376M probably benign Het
Bod1l G T 5: 41,821,967 T668K probably damaging Het
Ccdc87 A G 19: 4,841,631 E717G probably damaging Het
Cdh17 T A 4: 11,771,329 I37N probably damaging Het
Cfap99 T G 5: 34,301,397 F45L probably benign Het
Chsy1 C A 7: 66,172,400 H794Q probably benign Het
Clec4a3 G A 6: 122,954,086 V45I probably benign Het
Clic3 G A 2: 25,457,718 V32I probably benign Het
Clip2 A T 5: 134,502,730 D740E probably benign Het
Col5a2 C T 1: 45,386,844 V1062I probably benign Het
Col5a2 A G 1: 45,392,813 probably null Het
Cyp2j11 C T 4: 96,307,359 V367I probably damaging Het
Ddr1 C T 17: 35,682,758 A821T possibly damaging Het
Dna2 G A 10: 62,950,793 E107K probably benign Het
Eif3d A G 15: 77,959,694 V484A probably benign Het
Fgfr4 A G 13: 55,161,127 T354A probably benign Het
Fkbp6 T C 5: 135,349,632 D54G probably benign Het
Gm4787 T A 12: 81,379,246 E46V probably damaging Het
Gm47995 A G 1: 151,198,475 T10A possibly damaging Het
Gm498 T C 7: 143,883,976 V137A possibly damaging Het
Gnb1l T A 16: 18,540,995 I50N probably damaging Het
Gphb5 A T 12: 75,415,749 V22D probably damaging Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Hmces T C 6: 87,933,274 V222A possibly damaging Het
Kat14 T A 2: 144,373,782 D62E probably benign Het
Kcnmb2 T A 3: 32,181,869 V89E probably benign Het
Kif23 T A 9: 61,944,225 N63I probably benign Het
Lamc2 T C 1: 153,139,854 M578V probably benign Het
Ltbp2 A T 12: 84,789,153 C1335S probably benign Het
Lyst A G 13: 13,687,745 E2622G possibly damaging Het
Mctp1 A T 13: 76,384,674 H47L probably benign Het
Micalcl A G 7: 112,411,458 K618R probably damaging Het
Morc2a A G 11: 3,676,184 I223V probably benign Het
Msh3 A T 13: 92,345,086 I306N probably benign Het
Myo3b T A 2: 70,095,209 S35T probably benign Het
Nfkbiz A T 16: 55,813,984 V700E probably damaging Het
Oit3 T A 10: 59,441,683 M1L unknown Het
Olfr1048 A T 2: 86,236,472 I114K probably damaging Het
Olfr1231 A T 2: 89,302,731 I287N probably damaging Het
Olfr606 T A 7: 103,451,411 F25I probably benign Het
Peg3 T G 7: 6,707,999 D1408A probably damaging Het
Plaa A C 4: 94,586,883 S201R possibly damaging Het
Psmd5 A G 2: 34,854,326 S395P probably benign Het
Ralgapa2 T C 2: 146,334,554 I1701V probably damaging Het
Rnf32 G A 5: 29,206,186 A157T probably damaging Het
Rrad T A 8: 104,629,727 probably null Het
Samm50 T A 15: 84,207,841 L339Q probably damaging Het
Scin T C 12: 40,104,958 E212G possibly damaging Het
Scrib T C 15: 76,067,299 D146G probably damaging Het
Slc19a1 G A 10: 77,049,771 D502N probably benign Het
Slc4a4 T C 5: 89,214,573 S839P probably damaging Het
Slc4a8 A G 15: 100,806,260 D764G probably damaging Het
Slc6a19 G A 13: 73,681,765 A590V probably damaging Het
Slfn8 G T 11: 83,017,706 H4N probably benign Het
Smad9 T A 3: 54,789,335 F274I possibly damaging Het
Snx4 A G 16: 33,286,010 E271G probably benign Het
Thap4 G A 1: 93,750,306 R253* probably null Het
Tmem65 T A 15: 58,790,179 I144F Het
Tnrc6a G A 7: 123,179,735 R1223Q probably benign Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Trpm2 T C 10: 77,911,392 Y1424C possibly damaging Het
Trrap T A 5: 144,826,668 Y2457N probably damaging Het
Vmn1r7 A G 6: 57,024,523 S251P probably damaging Het
Vmn2r89 A T 14: 51,456,012 E273V probably damaging Het
Vps52 A G 17: 33,962,182 D466G probably damaging Het
Xirp2 T C 2: 67,515,632 V2739A probably benign Het
Zc3h4 C T 7: 16,434,750 S1003F unknown Het
Zyg11a A T 4: 108,217,905 H6Q probably damaging Het
Other mutations in Mllt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Mllt6 APN 11 97676928 missense probably damaging 1.00
IGL01808:Mllt6 APN 11 97672484 missense possibly damaging 0.88
IGL01967:Mllt6 APN 11 97674777 missense probably damaging 0.98
IGL02247:Mllt6 APN 11 97670332 missense probably benign 0.01
IGL03161:Mllt6 APN 11 97667151 missense probably benign 0.03
R0284:Mllt6 UTSW 11 97678605 missense probably benign 0.02
R0718:Mllt6 UTSW 11 97676359 splice site probably benign
R0783:Mllt6 UTSW 11 97665745 missense probably damaging 0.99
R0811:Mllt6 UTSW 11 97678561 missense probably damaging 0.97
R0812:Mllt6 UTSW 11 97678561 missense probably damaging 0.97
R0904:Mllt6 UTSW 11 97664998 missense probably damaging 1.00
R0960:Mllt6 UTSW 11 97664946 splice site probably benign
R1445:Mllt6 UTSW 11 97672451 splice site probably benign
R1523:Mllt6 UTSW 11 97665023 missense probably damaging 1.00
R1781:Mllt6 UTSW 11 97672569 missense probably benign
R1952:Mllt6 UTSW 11 97677222 missense probably damaging 0.99
R2258:Mllt6 UTSW 11 97664976 missense probably damaging 1.00
R2259:Mllt6 UTSW 11 97664976 missense probably damaging 1.00
R2927:Mllt6 UTSW 11 97680776 missense probably damaging 0.98
R4866:Mllt6 UTSW 11 97674459 missense probably damaging 1.00
R4938:Mllt6 UTSW 11 97678407 missense probably benign
R5039:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5058:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5064:Mllt6 UTSW 11 97673949 missense probably damaging 1.00
R5076:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5115:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5379:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5509:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5510:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5511:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5603:Mllt6 UTSW 11 97673505 missense probably damaging 1.00
R5816:Mllt6 UTSW 11 97672574 missense probably damaging 0.97
R6030:Mllt6 UTSW 11 97677225 missense probably damaging 0.99
R6030:Mllt6 UTSW 11 97677225 missense probably damaging 0.99
R6051:Mllt6 UTSW 11 97680743 nonsense probably null
R6180:Mllt6 UTSW 11 97678536 missense possibly damaging 0.85
R6277:Mllt6 UTSW 11 97673948 missense probably damaging 1.00
R6667:Mllt6 UTSW 11 97676934 missense probably damaging 1.00
R6754:Mllt6 UTSW 11 97674447 missense probably damaging 1.00
R6791:Mllt6 UTSW 11 97680602 missense probably damaging 0.98
R7049:Mllt6 UTSW 11 97673811 missense probably damaging 1.00
R7194:Mllt6 UTSW 11 97673568 missense probably benign 0.23
R7387:Mllt6 UTSW 11 97674600 missense probably benign 0.04
R7484:Mllt6 UTSW 11 97672616 missense probably benign 0.18
R7685:Mllt6 UTSW 11 97676964 missense probably damaging 0.99
R7853:Mllt6 UTSW 11 97670316 missense probably benign
R7862:Mllt6 UTSW 11 97665805 missense probably benign 0.03
R8004:Mllt6 UTSW 11 97676140 missense possibly damaging 0.91
R8498:Mllt6 UTSW 11 97676862 missense possibly damaging 0.86
R9044:Mllt6 UTSW 11 97663659 missense probably damaging 1.00
R9297:Mllt6 UTSW 11 97672488 missense probably damaging 0.96
R9557:Mllt6 UTSW 11 97673484 missense probably benign 0.04
Z1177:Mllt6 UTSW 11 97676425 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CGCACAAAGATGGGGCATTG -3'
(R):5'- ACCTATGAGCAACCCTCTGG -3'

Sequencing Primer
(F):5'- TGAACGCCTGCTGAGGTCAG -3'
(R):5'- TATGAGCAACCCTCTGGCTGTG -3'
Posted On 2022-06-15