Mutagenetix > Incidental Mutation

Incidental Mutation 'R9457:Fgfr4'

714675

Institutional Source

Beutler Lab

Gene Symbol

Fgfr4

Ensembl Gene

ENSMUSG00000005320

Gene Name

fibroblast growth factor receptor 4

Synonyms

Fgfr-4

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9457 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55152640-55168759 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55161127 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 354 (T354A)

Ref Sequence

ENSEMBL: ENSMUSP00000005452 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005452]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005452
AA Change: T354A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: T354A

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IGc2	45	105	1.39e-11	SMART
IGc2	160	228	3.1e-18	SMART
IGc2	259	337	1.59e-6	SMART
low complexity region	369	387	N/A	INTRINSIC
low complexity region	416	446	N/A	INTRINSIC
TyrKc	464	740	1.67e-148	SMART
low complexity region	764	795	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	A	G	18: 12,179,246	H181R	probably benign	Het
4930404N11Rik	C	A	10: 81,365,777	V4L	probably benign	Het
4930430A15Rik	A	T	2: 111,170,286	M196K	unknown	Het
4932415D10Rik	A	G	10: 82,286,739	V3479A	probably benign	Het
A930009A15Rik	T	C	10: 115,578,331	L54P	unknown	Het
Ablim3	A	G	18: 61,845,849	S204P	probably benign	Het
Acadl	A	G	1: 66,853,241	V141A	probably benign	Het
Ace3	A	G	11: 105,994,861	D31G	probably benign	Het
Adam11	T	G	11: 102,769,898	V85G	probably benign	Het
Adarb1	A	T	10: 77,322,148	M155K	possibly damaging	Het
Arhgap10	G	A	8: 77,384,786	T376M	probably benign	Het
Bod1l	G	T	5: 41,821,967	T668K	probably damaging	Het
Ccdc87	A	G	19: 4,841,631	E717G	probably damaging	Het
Cdh17	T	A	4: 11,771,329	I37N	probably damaging	Het
Cfap99	T	G	5: 34,301,397	F45L	probably benign	Het
Chsy1	C	A	7: 66,172,400	H794Q	probably benign	Het
Clec4a3	G	A	6: 122,954,086	V45I	probably benign	Het
Clic3	G	A	2: 25,457,718	V32I	probably benign	Het
Clip2	A	T	5: 134,502,730	D740E	probably benign	Het
Col5a2	C	T	1: 45,386,844	V1062I	probably benign	Het
Col5a2	A	G	1: 45,392,813		probably null	Het
Cyp2j11	C	T	4: 96,307,359	V367I	probably damaging	Het
Ddr1	C	T	17: 35,682,758	A821T	possibly damaging	Het
Dna2	G	A	10: 62,950,793	E107K	probably benign	Het
Eif3d	A	G	15: 77,959,694	V484A	probably benign	Het
Fkbp6	T	C	5: 135,349,632	D54G	probably benign	Het
Gm4787	T	A	12: 81,379,246	E46V	probably damaging	Het
Gm47995	A	G	1: 151,198,475	T10A	possibly damaging	Het
Gm498	T	C	7: 143,883,976	V137A	possibly damaging	Het
Gnb1l	T	A	16: 18,540,995	I50N	probably damaging	Het
Gphb5	A	T	12: 75,415,749	V22D	probably damaging	Het
Gstt4	C	T	10: 75,815,125	C221Y	probably benign	Het
Hmces	T	C	6: 87,933,274	V222A	possibly damaging	Het
Kat14	T	A	2: 144,373,782	D62E	probably benign	Het
Kcnmb2	T	A	3: 32,181,869	V89E	probably benign	Het
Kif23	T	A	9: 61,944,225	N63I	probably benign	Het
Lamc2	T	C	1: 153,139,854	M578V	probably benign	Het
Ltbp2	A	T	12: 84,789,153	C1335S	probably benign	Het
Lyst	A	G	13: 13,687,745	E2622G	possibly damaging	Het
Mctp1	A	T	13: 76,384,674	H47L	probably benign	Het
Micalcl	A	G	7: 112,411,458	K618R	probably damaging	Het
Mllt6	T	C	11: 97,665,760	I92T	probably benign	Het
Morc2a	A	G	11: 3,676,184	I223V	probably benign	Het
Msh3	A	T	13: 92,345,086	I306N	probably benign	Het
Myo3b	T	A	2: 70,095,209	S35T	probably benign	Het
Nfkbiz	A	T	16: 55,813,984	V700E	probably damaging	Het
Oit3	T	A	10: 59,441,683	M1L	unknown	Het
Olfr1048	A	T	2: 86,236,472	I114K	probably damaging	Het
Olfr1231	A	T	2: 89,302,731	I287N	probably damaging	Het
Olfr606	T	A	7: 103,451,411	F25I	probably benign	Het
Peg3	T	G	7: 6,707,999	D1408A	probably damaging	Het
Plaa	A	C	4: 94,586,883	S201R	possibly damaging	Het
Psmd5	A	G	2: 34,854,326	S395P	probably benign	Het
Ralgapa2	T	C	2: 146,334,554	I1701V	probably damaging	Het
Rnf32	G	A	5: 29,206,186	A157T	probably damaging	Het
Rrad	T	A	8: 104,629,727		probably null	Het
Samm50	T	A	15: 84,207,841	L339Q	probably damaging	Het
Scin	T	C	12: 40,104,958	E212G	possibly damaging	Het
Scrib	T	C	15: 76,067,299	D146G	probably damaging	Het
Slc19a1	G	A	10: 77,049,771	D502N	probably benign	Het
Slc4a4	T	C	5: 89,214,573	S839P	probably damaging	Het
Slc4a8	A	G	15: 100,806,260	D764G	probably damaging	Het
Slc6a19	G	A	13: 73,681,765	A590V	probably damaging	Het
Slfn8	G	T	11: 83,017,706	H4N	probably benign	Het
Smad9	T	A	3: 54,789,335	F274I	possibly damaging	Het
Snx4	A	G	16: 33,286,010	E271G	probably benign	Het
Thap4	G	A	1: 93,750,306	R253*	probably null	Het
Tmem65	T	A	15: 58,790,179	I144F		Het
Tnrc6a	G	A	7: 123,179,735	R1223Q	probably benign	Het
Traf7	CA	CAA	17: 24,527,763		probably benign	Het
Trpm2	T	C	10: 77,911,392	Y1424C	possibly damaging	Het
Trrap	T	A	5: 144,826,668	Y2457N	probably damaging	Het
Vmn1r7	A	G	6: 57,024,523	S251P	probably damaging	Het
Vmn2r89	A	T	14: 51,456,012	E273V	probably damaging	Het
Vps52	A	G	17: 33,962,182	D466G	probably damaging	Het
Xirp2	T	C	2: 67,515,632	V2739A	probably benign	Het
Zc3h4	C	T	7: 16,434,750	S1003F	unknown	Het
Zyg11a	A	T	4: 108,217,905	H6Q	probably damaging	Het

Other mutations in Fgfr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Fgfr4	APN	13	55159170	missense	probably damaging	0.99
IGL02140:Fgfr4	APN	13	55161179	missense	probably benign
IGL02817:Fgfr4	APN	13	55156668	critical splice donor site	probably null
interference	UTSW	13	55165964	missense	probably damaging	1.00
Modest	UTSW	13	55166251	missense	probably damaging	1.00
offense	UTSW	13	55161515	missense	possibly damaging	0.81
R0153:Fgfr4	UTSW	13	55161385	splice site	probably benign
R0727:Fgfr4	UTSW	13	55156228	splice site	probably null
R1646:Fgfr4	UTSW	13	55165964	missense	probably damaging	1.00
R1749:Fgfr4	UTSW	13	55167792	splice site	probably null
R1993:Fgfr4	UTSW	13	55165902	missense	probably damaging	1.00
R2037:Fgfr4	UTSW	13	55167889	missense	possibly damaging	0.51
R2152:Fgfr4	UTSW	13	55166964	missense	probably damaging	1.00
R2386:Fgfr4	UTSW	13	55167901	missense	probably benign	0.36
R3086:Fgfr4	UTSW	13	55167392	splice site	probably benign
R3939:Fgfr4	UTSW	13	55156494	missense	probably null	0.96
R4255:Fgfr4	UTSW	13	55166251	missense	probably damaging	1.00
R4463:Fgfr4	UTSW	13	55156467	missense	probably benign	0.02
R4510:Fgfr4	UTSW	13	55161515	missense	possibly damaging	0.81
R4511:Fgfr4	UTSW	13	55161515	missense	possibly damaging	0.81
R4852:Fgfr4	UTSW	13	55161156	missense	possibly damaging	0.68
R4932:Fgfr4	UTSW	13	55168170	missense	unknown
R5133:Fgfr4	UTSW	13	55160015	missense	probably damaging	1.00
R5146:Fgfr4	UTSW	13	55165912	missense	probably damaging	1.00
R5380:Fgfr4	UTSW	13	55167417	missense	probably damaging	1.00
R5431:Fgfr4	UTSW	13	55156651	missense	probably benign
R5927:Fgfr4	UTSW	13	55166887	missense	probably damaging	1.00
R6318:Fgfr4	UTSW	13	55166108	missense	probably damaging	1.00
R6792:Fgfr4	UTSW	13	55156898	missense	possibly damaging	0.65
R7018:Fgfr4	UTSW	13	55166200	missense	probably damaging	0.98
R7290:Fgfr4	UTSW	13	55161449	missense	probably benign	0.00
R7343:Fgfr4	UTSW	13	55159155	missense	probably damaging	1.00
R7808:Fgfr4	UTSW	13	55161156	missense	possibly damaging	0.68
R7891:Fgfr4	UTSW	13	55159151	missense	probably benign	0.22
R9028:Fgfr4	UTSW	13	55159154	missense	probably damaging	1.00
R9144:Fgfr4	UTSW	13	55168024	critical splice acceptor site	probably null
R9257:Fgfr4	UTSW	13	55168161	missense	unknown
R9399:Fgfr4	UTSW	13	55156480	missense	probably damaging	1.00
R9553:Fgfr4	UTSW	13	55161415	missense	probably damaging	0.99
R9620:Fgfr4	UTSW	13	55161181	missense	possibly damaging	0.68
Z1177:Fgfr4	UTSW	13	55161707	missense	probably damaging	1.00
Z1177:Fgfr4	UTSW	13	55165929	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATGTGACCCGTGGGAATATAAG -3'
(R):5'- GGAAACGGGACAGCTTTTG -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- AACGGGACAGCTTTTGTATAGTGAC -3'

Posted On

2022-06-15