Incidental Mutation 'R9457:Msh3'
ID 714678
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene Name mutS homolog 3
Synonyms Rep3, Rep-3, D13Em1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 92211872-92355003 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92345086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 306 (I306N)
Ref Sequence ENSEMBL: ENSMUSP00000140002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000190393] [ENSMUST00000191509] [ENSMUST00000191550]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: I306N

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185852
AA Change: I306N

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: I306N

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190393
SMART Domains Protein: ENSMUSP00000141163
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 241 6.4e-10 PFAM
low complexity region 261 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191509
SMART Domains Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,179,246 H181R probably benign Het
4930404N11Rik C A 10: 81,365,777 V4L probably benign Het
4930430A15Rik A T 2: 111,170,286 M196K unknown Het
4932415D10Rik A G 10: 82,286,739 V3479A probably benign Het
A930009A15Rik T C 10: 115,578,331 L54P unknown Het
Ablim3 A G 18: 61,845,849 S204P probably benign Het
Acadl A G 1: 66,853,241 V141A probably benign Het
Ace3 A G 11: 105,994,861 D31G probably benign Het
Adam11 T G 11: 102,769,898 V85G probably benign Het
Adarb1 A T 10: 77,322,148 M155K possibly damaging Het
Arhgap10 G A 8: 77,384,786 T376M probably benign Het
Bod1l G T 5: 41,821,967 T668K probably damaging Het
Ccdc87 A G 19: 4,841,631 E717G probably damaging Het
Cdh17 T A 4: 11,771,329 I37N probably damaging Het
Cfap99 T G 5: 34,301,397 F45L probably benign Het
Chsy1 C A 7: 66,172,400 H794Q probably benign Het
Clec4a3 G A 6: 122,954,086 V45I probably benign Het
Clic3 G A 2: 25,457,718 V32I probably benign Het
Clip2 A T 5: 134,502,730 D740E probably benign Het
Col5a2 C T 1: 45,386,844 V1062I probably benign Het
Col5a2 A G 1: 45,392,813 probably null Het
Cyp2j11 C T 4: 96,307,359 V367I probably damaging Het
Ddr1 C T 17: 35,682,758 A821T possibly damaging Het
Dna2 G A 10: 62,950,793 E107K probably benign Het
Eif3d A G 15: 77,959,694 V484A probably benign Het
Fgfr4 A G 13: 55,161,127 T354A probably benign Het
Fkbp6 T C 5: 135,349,632 D54G probably benign Het
Gm4787 T A 12: 81,379,246 E46V probably damaging Het
Gm47995 A G 1: 151,198,475 T10A possibly damaging Het
Gm498 T C 7: 143,883,976 V137A possibly damaging Het
Gnb1l T A 16: 18,540,995 I50N probably damaging Het
Gphb5 A T 12: 75,415,749 V22D probably damaging Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Hmces T C 6: 87,933,274 V222A possibly damaging Het
Kat14 T A 2: 144,373,782 D62E probably benign Het
Kcnmb2 T A 3: 32,181,869 V89E probably benign Het
Kif23 T A 9: 61,944,225 N63I probably benign Het
Lamc2 T C 1: 153,139,854 M578V probably benign Het
Ltbp2 A T 12: 84,789,153 C1335S probably benign Het
Lyst A G 13: 13,687,745 E2622G possibly damaging Het
Mctp1 A T 13: 76,384,674 H47L probably benign Het
Micalcl A G 7: 112,411,458 K618R probably damaging Het
Mllt6 T C 11: 97,665,760 I92T probably benign Het
Morc2a A G 11: 3,676,184 I223V probably benign Het
Myo3b T A 2: 70,095,209 S35T probably benign Het
Nfkbiz A T 16: 55,813,984 V700E probably damaging Het
Oit3 T A 10: 59,441,683 M1L unknown Het
Olfr1048 A T 2: 86,236,472 I114K probably damaging Het
Olfr1231 A T 2: 89,302,731 I287N probably damaging Het
Olfr606 T A 7: 103,451,411 F25I probably benign Het
Peg3 T G 7: 6,707,999 D1408A probably damaging Het
Plaa A C 4: 94,586,883 S201R possibly damaging Het
Psmd5 A G 2: 34,854,326 S395P probably benign Het
Ralgapa2 T C 2: 146,334,554 I1701V probably damaging Het
Rnf32 G A 5: 29,206,186 A157T probably damaging Het
Rrad T A 8: 104,629,727 probably null Het
Samm50 T A 15: 84,207,841 L339Q probably damaging Het
Scin T C 12: 40,104,958 E212G possibly damaging Het
Scrib T C 15: 76,067,299 D146G probably damaging Het
Slc19a1 G A 10: 77,049,771 D502N probably benign Het
Slc4a4 T C 5: 89,214,573 S839P probably damaging Het
Slc4a8 A G 15: 100,806,260 D764G probably damaging Het
Slc6a19 G A 13: 73,681,765 A590V probably damaging Het
Slfn8 G T 11: 83,017,706 H4N probably benign Het
Smad9 T A 3: 54,789,335 F274I possibly damaging Het
Snx4 A G 16: 33,286,010 E271G probably benign Het
Thap4 G A 1: 93,750,306 R253* probably null Het
Tmem65 T A 15: 58,790,179 I144F Het
Tnrc6a G A 7: 123,179,735 R1223Q probably benign Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Trpm2 T C 10: 77,911,392 Y1424C possibly damaging Het
Trrap T A 5: 144,826,668 Y2457N probably damaging Het
Vmn1r7 A G 6: 57,024,523 S251P probably damaging Het
Vmn2r89 A T 14: 51,456,012 E273V probably damaging Het
Vps52 A G 17: 33,962,182 D466G probably damaging Het
Xirp2 T C 2: 67,515,632 V2739A probably benign Het
Zc3h4 C T 7: 16,434,750 S1003F unknown Het
Zyg11a A T 4: 108,217,905 H6Q probably damaging Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.86
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
R7022:Msh3 UTSW 13 92235588 missense probably damaging 1.00
R7098:Msh3 UTSW 13 92274111 missense possibly damaging 0.95
R7103:Msh3 UTSW 13 92274800 missense probably benign
R7148:Msh3 UTSW 13 92354822 missense probably benign 0.18
R7171:Msh3 UTSW 13 92349298 missense probably benign 0.00
R7317:Msh3 UTSW 13 92286004 missense probably damaging 1.00
R7369:Msh3 UTSW 13 92299262 missense probably benign 0.15
R7586:Msh3 UTSW 13 92349332 utr 3 prime probably benign
R7641:Msh3 UTSW 13 92212503 missense probably benign 0.08
R7648:Msh3 UTSW 13 92274028 missense probably damaging 1.00
R7674:Msh3 UTSW 13 92212503 missense probably benign 0.08
R8125:Msh3 UTSW 13 92299182 missense probably benign
R8252:Msh3 UTSW 13 92221061 missense probably damaging 1.00
R8388:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R8442:Msh3 UTSW 13 92212512 missense probably benign 0.00
R8735:Msh3 UTSW 13 92274866 missense possibly damaging 0.94
R8986:Msh3 UTSW 13 92346826 missense probably damaging 1.00
R9264:Msh3 UTSW 13 92349304 missense probably benign 0.00
R9326:Msh3 UTSW 13 92263799 missense probably benign 0.15
R9459:Msh3 UTSW 13 92215539 missense possibly damaging 0.91
R9648:Msh3 UTSW 13 92342249 missense probably benign 0.00
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATCCTCATGACGTACCGC -3'
(R):5'- TAGCCCCTTTGGAATTGAGAAG -3'

Sequencing Primer
(F):5'- CAACGTTGGCACACGAGGTAC -3'
(R):5'- AGATAATAGTTACCTGTCCTTGTACC -3'
Posted On 2022-06-15