Incidental Mutation 'R9457:Samm50'
ID 714683
Institutional Source Beutler Lab
Gene Symbol Samm50
Ensembl Gene ENSMUSG00000022437
Gene Name SAMM50 sorting and assembly machinery component
Synonyms 1110030L07Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.955) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 84076441-84100284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84092042 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 339 (L339Q)
Ref Sequence ENSEMBL: ENSMUSP00000023071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023071]
AlphaFold Q8BGH2
Predicted Effect probably damaging
Transcript: ENSMUST00000023071
AA Change: L339Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437
AA Change: L339Q

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:Bac_surface_Ag 151 468 1.8e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik T C 10: 115,414,236 (GRCm39) L54P unknown Het
Ablim3 A G 18: 61,978,920 (GRCm39) S204P probably benign Het
Acadl A G 1: 66,892,400 (GRCm39) V141A probably benign Het
Ace3 A G 11: 105,885,687 (GRCm39) D31G probably benign Het
Acte1 T C 7: 143,437,713 (GRCm39) V137A possibly damaging Het
Adam11 T G 11: 102,660,724 (GRCm39) V85G probably benign Het
Adarb1 A T 10: 77,157,982 (GRCm39) M155K possibly damaging Het
Arhgap10 G A 8: 78,111,415 (GRCm39) T376M probably benign Het
Bod1l G T 5: 41,979,310 (GRCm39) T668K probably damaging Het
Ccdc87 A G 19: 4,891,659 (GRCm39) E717G probably damaging Het
Cdh17 T A 4: 11,771,329 (GRCm39) I37N probably damaging Het
Cfap99 T G 5: 34,458,741 (GRCm39) F45L probably benign Het
Chsy1 C A 7: 65,822,148 (GRCm39) H794Q probably benign Het
Clec4a3 G A 6: 122,931,045 (GRCm39) V45I probably benign Het
Clic3 G A 2: 25,347,730 (GRCm39) V32I probably benign Het
Clip2 A T 5: 134,531,584 (GRCm39) D740E probably benign Het
Col5a2 C T 1: 45,426,004 (GRCm39) V1062I probably benign Het
Col5a2 A G 1: 45,431,973 (GRCm39) probably null Het
Cyp2j11 C T 4: 96,195,596 (GRCm39) V367I probably damaging Het
Ddr1 C T 17: 35,993,650 (GRCm39) A821T possibly damaging Het
Dna2 G A 10: 62,786,572 (GRCm39) E107K probably benign Het
Eif3d A G 15: 77,843,894 (GRCm39) V484A probably benign Het
Fgfr4 A G 13: 55,308,940 (GRCm39) T354A probably benign Het
Fkbp6 T C 5: 135,378,486 (GRCm39) D54G probably benign Het
Gm4787 T A 12: 81,426,020 (GRCm39) E46V probably damaging Het
Gm47995 A G 1: 151,074,226 (GRCm39) T10A possibly damaging Het
Gnb1l T A 16: 18,359,745 (GRCm39) I50N probably damaging Het
Gphb5 A T 12: 75,462,523 (GRCm39) V22D probably damaging Het
Gstt4 C T 10: 75,650,959 (GRCm39) C221Y probably benign Het
Hmces T C 6: 87,910,256 (GRCm39) V222A possibly damaging Het
Kat14 T A 2: 144,215,702 (GRCm39) D62E probably benign Het
Kcnmb2 T A 3: 32,236,018 (GRCm39) V89E probably benign Het
Kif23 T A 9: 61,851,507 (GRCm39) N63I probably benign Het
Lamc2 T C 1: 153,015,600 (GRCm39) M578V probably benign Het
Ltbp2 A T 12: 84,835,927 (GRCm39) C1335S probably benign Het
Lyst A G 13: 13,862,330 (GRCm39) E2622G possibly damaging Het
Mctp1 A T 13: 76,532,793 (GRCm39) H47L probably benign Het
Mical2 A G 7: 112,010,665 (GRCm39) K618R probably damaging Het
Mllt6 T C 11: 97,556,586 (GRCm39) I92T probably benign Het
Morc2a A G 11: 3,626,184 (GRCm39) I223V probably benign Het
Msh3 A T 13: 92,481,594 (GRCm39) I306N probably benign Het
Myo3b T A 2: 69,925,553 (GRCm39) S35T probably benign Het
Nfkbiz A T 16: 55,634,347 (GRCm39) V700E probably damaging Het
Oit3 T A 10: 59,277,505 (GRCm39) M1L unknown Het
Or4c1 A T 2: 89,133,075 (GRCm39) I287N probably damaging Het
Or51l14 T A 7: 103,100,618 (GRCm39) F25I probably benign Het
Or8k17 A T 2: 86,066,816 (GRCm39) I114K probably damaging Het
Peg3 T G 7: 6,710,998 (GRCm39) D1408A probably damaging Het
Plaa A C 4: 94,475,120 (GRCm39) S201R possibly damaging Het
Potefam1 A T 2: 111,000,631 (GRCm39) M196K unknown Het
Psmd5 A G 2: 34,744,338 (GRCm39) S395P probably benign Het
Ralgapa2 T C 2: 146,176,474 (GRCm39) I1701V probably damaging Het
Rmc1 A G 18: 12,312,303 (GRCm39) H181R probably benign Het
Rnf32 G A 5: 29,411,184 (GRCm39) A157T probably damaging Het
Rrad T A 8: 105,356,359 (GRCm39) probably null Het
Scin T C 12: 40,154,957 (GRCm39) E212G possibly damaging Het
Scrib T C 15: 75,939,148 (GRCm39) D146G probably damaging Het
Slc19a1 G A 10: 76,885,605 (GRCm39) D502N probably benign Het
Slc4a4 T C 5: 89,362,432 (GRCm39) S839P probably damaging Het
Slc4a8 A G 15: 100,704,141 (GRCm39) D764G probably damaging Het
Slc6a19 G A 13: 73,829,884 (GRCm39) A590V probably damaging Het
Slfn8 G T 11: 82,908,532 (GRCm39) H4N probably benign Het
Smad9 T A 3: 54,696,756 (GRCm39) F274I possibly damaging Het
Snx4 A G 16: 33,106,380 (GRCm39) E271G probably benign Het
Spata31h1 A G 10: 82,122,573 (GRCm39) V3479A probably benign Het
Tektip1 C A 10: 81,201,611 (GRCm39) V4L probably benign Het
Thap4 G A 1: 93,678,028 (GRCm39) R253* probably null Het
Tmem65 T A 15: 58,662,028 (GRCm39) I144F Het
Tnrc6a G A 7: 122,778,958 (GRCm39) R1223Q probably benign Het
Traf7 CA CAA 17: 24,746,737 (GRCm39) probably benign Het
Trpm2 T C 10: 77,747,226 (GRCm39) Y1424C possibly damaging Het
Trrap T A 5: 144,763,478 (GRCm39) Y2457N probably damaging Het
Vmn1r7 A G 6: 57,001,508 (GRCm39) S251P probably damaging Het
Vmn2r89 A T 14: 51,693,469 (GRCm39) E273V probably damaging Het
Vps52 A G 17: 34,181,156 (GRCm39) D466G probably damaging Het
Xirp2 T C 2: 67,345,976 (GRCm39) V2739A probably benign Het
Zc3h4 C T 7: 16,168,675 (GRCm39) S1003F unknown Het
Zyg11a A T 4: 108,075,102 (GRCm39) H6Q probably damaging Het
Other mutations in Samm50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Samm50 APN 15 84,084,576 (GRCm39) missense possibly damaging 0.82
IGL01061:Samm50 APN 15 84,086,455 (GRCm39) missense probably benign 0.00
IGL01549:Samm50 APN 15 84,086,982 (GRCm39) missense probably benign
IGL01586:Samm50 APN 15 84,080,039 (GRCm39) missense probably benign 0.03
IGL02494:Samm50 APN 15 84,080,015 (GRCm39) missense probably benign
IGL02607:Samm50 APN 15 84,092,039 (GRCm39) missense probably benign 0.09
IGL03244:Samm50 APN 15 84,098,341 (GRCm39) missense probably benign 0.09
IGL03340:Samm50 APN 15 84,082,864 (GRCm39) critical splice donor site probably null
R0591:Samm50 UTSW 15 84,095,369 (GRCm39) missense probably benign
R0634:Samm50 UTSW 15 84,098,372 (GRCm39) synonymous silent
R1780:Samm50 UTSW 15 84,095,328 (GRCm39) missense probably damaging 0.99
R2192:Samm50 UTSW 15 84,084,625 (GRCm39) critical splice donor site probably null
R2205:Samm50 UTSW 15 84,086,515 (GRCm39) missense probably benign 0.01
R3800:Samm50 UTSW 15 84,076,575 (GRCm39) missense probably damaging 0.99
R4285:Samm50 UTSW 15 84,081,213 (GRCm39) missense probably damaging 1.00
R4333:Samm50 UTSW 15 84,087,031 (GRCm39) missense probably benign 0.02
R4780:Samm50 UTSW 15 84,094,811 (GRCm39) missense possibly damaging 0.88
R5223:Samm50 UTSW 15 84,084,831 (GRCm39) missense probably benign 0.07
R5639:Samm50 UTSW 15 84,098,329 (GRCm39) missense probably benign 0.22
R6258:Samm50 UTSW 15 84,084,513 (GRCm39) missense probably damaging 0.98
R6258:Samm50 UTSW 15 84,084,512 (GRCm39) missense probably damaging 1.00
R6437:Samm50 UTSW 15 84,088,298 (GRCm39) critical splice donor site probably null
R6452:Samm50 UTSW 15 84,088,298 (GRCm39) critical splice donor site probably benign
R6715:Samm50 UTSW 15 84,095,259 (GRCm39) missense probably benign
R6957:Samm50 UTSW 15 84,082,850 (GRCm39) missense probably damaging 1.00
R7409:Samm50 UTSW 15 84,081,231 (GRCm39) missense probably benign 0.32
R7459:Samm50 UTSW 15 84,080,057 (GRCm39) critical splice donor site probably null
R7706:Samm50 UTSW 15 84,085,081 (GRCm39) splice site probably null
R7910:Samm50 UTSW 15 84,098,346 (GRCm39) missense possibly damaging 0.49
R8421:Samm50 UTSW 15 84,094,786 (GRCm39) missense probably benign 0.04
R8443:Samm50 UTSW 15 84,094,702 (GRCm39) missense possibly damaging 0.82
R9339:Samm50 UTSW 15 84,095,276 (GRCm39) missense probably benign 0.00
X0067:Samm50 UTSW 15 84,087,034 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGAGTGAACTGTGTCTTATATGC -3'
(R):5'- TGCTACTGCTCGCACTGTTG -3'

Sequencing Primer
(F):5'- ACAGGGTTTCTCTGTGTAGCCC -3'
(R):5'- GCAAGCTGCTATTCCCATCAC -3'
Posted On 2022-06-15