Incidental Mutation 'R9457:Gnb1l'
ID 714685
Institutional Source Beutler Lab
Gene Symbol Gnb1l
Ensembl Gene ENSMUSG00000000884
Gene Name guanine nucleotide binding protein (G protein), beta polypeptide 1-like
Synonyms ESTM55, Wdvcf, Wdr14, Me49f07
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 18498713-18566679 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18540995 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 50 (I50N)
Ref Sequence ENSEMBL: ENSMUSP00000130371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000904] [ENSMUST00000090086] [ENSMUST00000115600] [ENSMUST00000115601] [ENSMUST00000139625] [ENSMUST00000147739] [ENSMUST00000149035] [ENSMUST00000167778] [ENSMUST00000231621]
AlphaFold Q9EQ15
Predicted Effect probably damaging
Transcript: ENSMUST00000000904
AA Change: I50N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000904
Gene: ENSMUSG00000000884
AA Change: I50N

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 112 143 1e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000090086
AA Change: I50N

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087544
Gene: ENSMUSG00000000884
AA Change: I50N

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
WD40 146 193 9.17e1 SMART
WD40 196 235 4.79e-1 SMART
WD40 238 280 4.79e-1 SMART
WD40 283 321 6.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115600
AA Change: I50N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111263
Gene: ENSMUSG00000000884
AA Change: I50N

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 136 188 3e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000115601
AA Change: I50N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111264
Gene: ENSMUSG00000000884
AA Change: I50N

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Blast:WD40 138 179 1e-16 BLAST
WD40 182 221 4.79e-1 SMART
WD40 224 266 4.79e-1 SMART
WD40 269 307 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139625
SMART Domains Protein: ENSMUSP00000120897
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
Blast:WD40 35 75 2e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000147739
AA Change: I50N

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123200
Gene: ENSMUSG00000000884
AA Change: I50N

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149035
SMART Domains Protein: ENSMUSP00000114875
Gene: ENSMUSG00000000884

DomainStartEndE-ValueType
Blast:WD40 35 76 8e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000167778
AA Change: I50N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130371
Gene: ENSMUSG00000000884
AA Change: I50N

DomainStartEndE-ValueType
WD40 8 52 1.12e-2 SMART
WD40 55 95 1.36e-1 SMART
WD40 146 193 9.17e1 SMART
WD40 196 235 4.79e-1 SMART
WD40 238 280 4.79e-1 SMART
WD40 283 321 6.04e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000231621
AA Change: I50N

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein beta-subunit-like polypeptide which is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 6 WD repeats and is highly expressed in the heart. The gene maps to the region on chromosome 22q11, which is deleted in DiGeorge syndrome, trisomic in derivative 22 syndrome and tetrasomic in cat-eye syndrome. Therefore, this gene may contribute to the etiology of those disorders. Transcripts from this gene share exons with some transcripts from the C22orf29 gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a gene trapped allele exhibit significantly reduced prepulse inhibition. Homozygotes die during early gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,179,246 H181R probably benign Het
4930404N11Rik C A 10: 81,365,777 V4L probably benign Het
4930430A15Rik A T 2: 111,170,286 M196K unknown Het
4932415D10Rik A G 10: 82,286,739 V3479A probably benign Het
A930009A15Rik T C 10: 115,578,331 L54P unknown Het
Ablim3 A G 18: 61,845,849 S204P probably benign Het
Acadl A G 1: 66,853,241 V141A probably benign Het
Ace3 A G 11: 105,994,861 D31G probably benign Het
Adam11 T G 11: 102,769,898 V85G probably benign Het
Adarb1 A T 10: 77,322,148 M155K possibly damaging Het
Arhgap10 G A 8: 77,384,786 T376M probably benign Het
Bod1l G T 5: 41,821,967 T668K probably damaging Het
Ccdc87 A G 19: 4,841,631 E717G probably damaging Het
Cdh17 T A 4: 11,771,329 I37N probably damaging Het
Cfap99 T G 5: 34,301,397 F45L probably benign Het
Chsy1 C A 7: 66,172,400 H794Q probably benign Het
Clec4a3 G A 6: 122,954,086 V45I probably benign Het
Clic3 G A 2: 25,457,718 V32I probably benign Het
Clip2 A T 5: 134,502,730 D740E probably benign Het
Col5a2 C T 1: 45,386,844 V1062I probably benign Het
Col5a2 A G 1: 45,392,813 probably null Het
Cyp2j11 C T 4: 96,307,359 V367I probably damaging Het
Ddr1 C T 17: 35,682,758 A821T possibly damaging Het
Dna2 G A 10: 62,950,793 E107K probably benign Het
Eif3d A G 15: 77,959,694 V484A probably benign Het
Fgfr4 A G 13: 55,161,127 T354A probably benign Het
Fkbp6 T C 5: 135,349,632 D54G probably benign Het
Gm4787 T A 12: 81,379,246 E46V probably damaging Het
Gm47995 A G 1: 151,198,475 T10A possibly damaging Het
Gm498 T C 7: 143,883,976 V137A possibly damaging Het
Gphb5 A T 12: 75,415,749 V22D probably damaging Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Hmces T C 6: 87,933,274 V222A possibly damaging Het
Kat14 T A 2: 144,373,782 D62E probably benign Het
Kcnmb2 T A 3: 32,181,869 V89E probably benign Het
Kif23 T A 9: 61,944,225 N63I probably benign Het
Lamc2 T C 1: 153,139,854 M578V probably benign Het
Ltbp2 A T 12: 84,789,153 C1335S probably benign Het
Lyst A G 13: 13,687,745 E2622G possibly damaging Het
Mctp1 A T 13: 76,384,674 H47L probably benign Het
Micalcl A G 7: 112,411,458 K618R probably damaging Het
Mllt6 T C 11: 97,665,760 I92T probably benign Het
Morc2a A G 11: 3,676,184 I223V probably benign Het
Msh3 A T 13: 92,345,086 I306N probably benign Het
Myo3b T A 2: 70,095,209 S35T probably benign Het
Nfkbiz A T 16: 55,813,984 V700E probably damaging Het
Oit3 T A 10: 59,441,683 M1L unknown Het
Olfr1048 A T 2: 86,236,472 I114K probably damaging Het
Olfr1231 A T 2: 89,302,731 I287N probably damaging Het
Olfr606 T A 7: 103,451,411 F25I probably benign Het
Peg3 T G 7: 6,707,999 D1408A probably damaging Het
Plaa A C 4: 94,586,883 S201R possibly damaging Het
Psmd5 A G 2: 34,854,326 S395P probably benign Het
Ralgapa2 T C 2: 146,334,554 I1701V probably damaging Het
Rnf32 G A 5: 29,206,186 A157T probably damaging Het
Rrad T A 8: 104,629,727 probably null Het
Samm50 T A 15: 84,207,841 L339Q probably damaging Het
Scin T C 12: 40,104,958 E212G possibly damaging Het
Scrib T C 15: 76,067,299 D146G probably damaging Het
Slc19a1 G A 10: 77,049,771 D502N probably benign Het
Slc4a4 T C 5: 89,214,573 S839P probably damaging Het
Slc4a8 A G 15: 100,806,260 D764G probably damaging Het
Slc6a19 G A 13: 73,681,765 A590V probably damaging Het
Slfn8 G T 11: 83,017,706 H4N probably benign Het
Smad9 T A 3: 54,789,335 F274I possibly damaging Het
Snx4 A G 16: 33,286,010 E271G probably benign Het
Thap4 G A 1: 93,750,306 R253* probably null Het
Tmem65 T A 15: 58,790,179 I144F Het
Tnrc6a G A 7: 123,179,735 R1223Q probably benign Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Trpm2 T C 10: 77,911,392 Y1424C possibly damaging Het
Trrap T A 5: 144,826,668 Y2457N probably damaging Het
Vmn1r7 A G 6: 57,024,523 S251P probably damaging Het
Vmn2r89 A T 14: 51,456,012 E273V probably damaging Het
Vps52 A G 17: 33,962,182 D466G probably damaging Het
Xirp2 T C 2: 67,515,632 V2739A probably benign Het
Zc3h4 C T 7: 16,434,750 S1003F unknown Het
Zyg11a A T 4: 108,217,905 H6Q probably damaging Het
Other mutations in Gnb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Gnb1l APN 16 18544200 missense probably damaging 1.00
IGL02860:Gnb1l APN 16 18552535 missense probably damaging 0.99
IGL03155:Gnb1l APN 16 18540532 splice site probably null
IGL03169:Gnb1l APN 16 18540455 missense probably damaging 1.00
R0017:Gnb1l UTSW 16 18541060 missense probably damaging 1.00
R0267:Gnb1l UTSW 16 18548089 splice site probably benign
R0365:Gnb1l UTSW 16 18552461 missense possibly damaging 0.95
R0845:Gnb1l UTSW 16 18552473 missense probably benign 0.01
R2975:Gnb1l UTSW 16 18564266 missense probably damaging 1.00
R3438:Gnb1l UTSW 16 18552367 missense probably benign 0.01
R3439:Gnb1l UTSW 16 18552367 missense probably benign 0.01
R4650:Gnb1l UTSW 16 18544275 critical splice donor site probably null
R4776:Gnb1l UTSW 16 18548096 nonsense probably null
R7135:Gnb1l UTSW 16 18545168 missense probably benign 0.05
R7290:Gnb1l UTSW 16 18564056 missense probably benign 0.37
R7488:Gnb1l UTSW 16 18540470 missense possibly damaging 0.90
R8195:Gnb1l UTSW 16 18544215 missense probably benign 0.44
R9074:Gnb1l UTSW 16 18540995 missense probably damaging 1.00
R9593:Gnb1l UTSW 16 18544164 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CAAGGGAGGCTTGTCTGATC -3'
(R):5'- CACAAGCTGCAGCCAAGTTG -3'

Sequencing Primer
(F):5'- GATCTTTGGTTCAGCGTCAGCC -3'
(R):5'- AAGTTGGCCAGATCCACG -3'
Posted On 2022-06-15