Incidental Mutation 'R9457:Nfkbiz'
ID 714687
Institutional Source Beutler Lab
Gene Symbol Nfkbiz
Ensembl Gene ENSMUSG00000035356
Gene Name nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta
Synonyms Mail
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.646) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 55631740-55659018 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55634347 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 700 (V700E)
Ref Sequence ENSEMBL: ENSMUSP00000041173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036273] [ENSMUST00000096026] [ENSMUST00000114457] [ENSMUST00000114458]
AlphaFold Q9EST8
Predicted Effect probably damaging
Transcript: ENSMUST00000036273
AA Change: V700E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041173
Gene: ENSMUSG00000035356
AA Change: V700E

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096026
AA Change: V601E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093726
Gene: ENSMUSG00000035356
AA Change: V601E

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114457
AA Change: V601E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110101
Gene: ENSMUSG00000035356
AA Change: V601E

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114458
AA Change: V700E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110102
Gene: ENSMUSG00000035356
AA Change: V700E

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Meta Mutation Damage Score 0.6201 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ankyrin-repeat family and is induced by lipopolysaccharide (LPS). The C-terminal portion of the encoded product which contains the ankyrin repeats, shares high sequence similarity with the I kappa B family of proteins. The latter are known to play a role in inflammatory responses to LPS by their interaction with NF-B proteins through ankyrin-repeat domains. Studies in mouse indicate that this gene product is one of the nuclear I kappa B proteins and an activator of IL-6 production. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene may lead to background sensitive prenatal lethality and results in abnormal cytokine secretion, higher IgE levels, ocular surface and perioral skin inflammation accompanied by hair loss, and severe atopic dermatitis-like skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik T C 10: 115,414,236 (GRCm39) L54P unknown Het
Ablim3 A G 18: 61,978,920 (GRCm39) S204P probably benign Het
Acadl A G 1: 66,892,400 (GRCm39) V141A probably benign Het
Ace3 A G 11: 105,885,687 (GRCm39) D31G probably benign Het
Acte1 T C 7: 143,437,713 (GRCm39) V137A possibly damaging Het
Adam11 T G 11: 102,660,724 (GRCm39) V85G probably benign Het
Adarb1 A T 10: 77,157,982 (GRCm39) M155K possibly damaging Het
Arhgap10 G A 8: 78,111,415 (GRCm39) T376M probably benign Het
Bod1l G T 5: 41,979,310 (GRCm39) T668K probably damaging Het
Ccdc87 A G 19: 4,891,659 (GRCm39) E717G probably damaging Het
Cdh17 T A 4: 11,771,329 (GRCm39) I37N probably damaging Het
Cfap99 T G 5: 34,458,741 (GRCm39) F45L probably benign Het
Chsy1 C A 7: 65,822,148 (GRCm39) H794Q probably benign Het
Clec4a3 G A 6: 122,931,045 (GRCm39) V45I probably benign Het
Clic3 G A 2: 25,347,730 (GRCm39) V32I probably benign Het
Clip2 A T 5: 134,531,584 (GRCm39) D740E probably benign Het
Col5a2 C T 1: 45,426,004 (GRCm39) V1062I probably benign Het
Col5a2 A G 1: 45,431,973 (GRCm39) probably null Het
Cyp2j11 C T 4: 96,195,596 (GRCm39) V367I probably damaging Het
Ddr1 C T 17: 35,993,650 (GRCm39) A821T possibly damaging Het
Dna2 G A 10: 62,786,572 (GRCm39) E107K probably benign Het
Eif3d A G 15: 77,843,894 (GRCm39) V484A probably benign Het
Fgfr4 A G 13: 55,308,940 (GRCm39) T354A probably benign Het
Fkbp6 T C 5: 135,378,486 (GRCm39) D54G probably benign Het
Gm4787 T A 12: 81,426,020 (GRCm39) E46V probably damaging Het
Gm47995 A G 1: 151,074,226 (GRCm39) T10A possibly damaging Het
Gnb1l T A 16: 18,359,745 (GRCm39) I50N probably damaging Het
Gphb5 A T 12: 75,462,523 (GRCm39) V22D probably damaging Het
Gstt4 C T 10: 75,650,959 (GRCm39) C221Y probably benign Het
Hmces T C 6: 87,910,256 (GRCm39) V222A possibly damaging Het
Kat14 T A 2: 144,215,702 (GRCm39) D62E probably benign Het
Kcnmb2 T A 3: 32,236,018 (GRCm39) V89E probably benign Het
Kif23 T A 9: 61,851,507 (GRCm39) N63I probably benign Het
Lamc2 T C 1: 153,015,600 (GRCm39) M578V probably benign Het
Ltbp2 A T 12: 84,835,927 (GRCm39) C1335S probably benign Het
Lyst A G 13: 13,862,330 (GRCm39) E2622G possibly damaging Het
Mctp1 A T 13: 76,532,793 (GRCm39) H47L probably benign Het
Mical2 A G 7: 112,010,665 (GRCm39) K618R probably damaging Het
Mllt6 T C 11: 97,556,586 (GRCm39) I92T probably benign Het
Morc2a A G 11: 3,626,184 (GRCm39) I223V probably benign Het
Msh3 A T 13: 92,481,594 (GRCm39) I306N probably benign Het
Myo3b T A 2: 69,925,553 (GRCm39) S35T probably benign Het
Oit3 T A 10: 59,277,505 (GRCm39) M1L unknown Het
Or4c1 A T 2: 89,133,075 (GRCm39) I287N probably damaging Het
Or51l14 T A 7: 103,100,618 (GRCm39) F25I probably benign Het
Or8k17 A T 2: 86,066,816 (GRCm39) I114K probably damaging Het
Peg3 T G 7: 6,710,998 (GRCm39) D1408A probably damaging Het
Plaa A C 4: 94,475,120 (GRCm39) S201R possibly damaging Het
Potefam1 A T 2: 111,000,631 (GRCm39) M196K unknown Het
Psmd5 A G 2: 34,744,338 (GRCm39) S395P probably benign Het
Ralgapa2 T C 2: 146,176,474 (GRCm39) I1701V probably damaging Het
Rmc1 A G 18: 12,312,303 (GRCm39) H181R probably benign Het
Rnf32 G A 5: 29,411,184 (GRCm39) A157T probably damaging Het
Rrad T A 8: 105,356,359 (GRCm39) probably null Het
Samm50 T A 15: 84,092,042 (GRCm39) L339Q probably damaging Het
Scin T C 12: 40,154,957 (GRCm39) E212G possibly damaging Het
Scrib T C 15: 75,939,148 (GRCm39) D146G probably damaging Het
Slc19a1 G A 10: 76,885,605 (GRCm39) D502N probably benign Het
Slc4a4 T C 5: 89,362,432 (GRCm39) S839P probably damaging Het
Slc4a8 A G 15: 100,704,141 (GRCm39) D764G probably damaging Het
Slc6a19 G A 13: 73,829,884 (GRCm39) A590V probably damaging Het
Slfn8 G T 11: 82,908,532 (GRCm39) H4N probably benign Het
Smad9 T A 3: 54,696,756 (GRCm39) F274I possibly damaging Het
Snx4 A G 16: 33,106,380 (GRCm39) E271G probably benign Het
Spata31h1 A G 10: 82,122,573 (GRCm39) V3479A probably benign Het
Tektip1 C A 10: 81,201,611 (GRCm39) V4L probably benign Het
Thap4 G A 1: 93,678,028 (GRCm39) R253* probably null Het
Tmem65 T A 15: 58,662,028 (GRCm39) I144F Het
Tnrc6a G A 7: 122,778,958 (GRCm39) R1223Q probably benign Het
Traf7 CA CAA 17: 24,746,737 (GRCm39) probably benign Het
Trpm2 T C 10: 77,747,226 (GRCm39) Y1424C possibly damaging Het
Trrap T A 5: 144,763,478 (GRCm39) Y2457N probably damaging Het
Vmn1r7 A G 6: 57,001,508 (GRCm39) S251P probably damaging Het
Vmn2r89 A T 14: 51,693,469 (GRCm39) E273V probably damaging Het
Vps52 A G 17: 34,181,156 (GRCm39) D466G probably damaging Het
Xirp2 T C 2: 67,345,976 (GRCm39) V2739A probably benign Het
Zc3h4 C T 7: 16,168,675 (GRCm39) S1003F unknown Het
Zyg11a A T 4: 108,075,102 (GRCm39) H6Q probably damaging Het
Other mutations in Nfkbiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nfkbiz APN 16 55,638,272 (GRCm39) missense probably benign
IGL01324:Nfkbiz APN 16 55,636,167 (GRCm39) missense probably damaging 1.00
IGL02086:Nfkbiz APN 16 55,636,034 (GRCm39) missense probably damaging 1.00
IGL02627:Nfkbiz APN 16 55,636,714 (GRCm39) missense probably damaging 1.00
IGL02740:Nfkbiz APN 16 55,638,317 (GRCm39) missense probably benign
R0349:Nfkbiz UTSW 16 55,639,354 (GRCm39) critical splice donor site probably null
R0539:Nfkbiz UTSW 16 55,638,242 (GRCm39) missense probably benign 0.08
R0827:Nfkbiz UTSW 16 55,636,730 (GRCm39) missense probably damaging 1.00
R1403:Nfkbiz UTSW 16 55,636,833 (GRCm39) splice site probably benign
R1743:Nfkbiz UTSW 16 55,636,757 (GRCm39) missense possibly damaging 0.82
R2090:Nfkbiz UTSW 16 55,636,818 (GRCm39) missense probably benign 0.01
R2163:Nfkbiz UTSW 16 55,638,581 (GRCm39) missense probably benign 0.00
R3195:Nfkbiz UTSW 16 55,639,991 (GRCm39) missense probably damaging 1.00
R3974:Nfkbiz UTSW 16 55,638,799 (GRCm39) missense probably benign 0.42
R4513:Nfkbiz UTSW 16 55,637,204 (GRCm39) missense probably benign 0.20
R4765:Nfkbiz UTSW 16 55,639,387 (GRCm39) critical splice acceptor site probably null
R4864:Nfkbiz UTSW 16 55,638,787 (GRCm39) missense probably damaging 1.00
R5134:Nfkbiz UTSW 16 55,638,863 (GRCm39) missense probably damaging 1.00
R5265:Nfkbiz UTSW 16 55,640,004 (GRCm39) missense probably damaging 1.00
R5510:Nfkbiz UTSW 16 55,634,383 (GRCm39) missense probably damaging 1.00
R6327:Nfkbiz UTSW 16 55,642,325 (GRCm39) missense probably damaging 1.00
R7083:Nfkbiz UTSW 16 55,638,663 (GRCm39) missense possibly damaging 0.88
R7369:Nfkbiz UTSW 16 55,642,209 (GRCm39) missense probably damaging 1.00
R7650:Nfkbiz UTSW 16 55,638,202 (GRCm39) missense probably benign 0.34
R7941:Nfkbiz UTSW 16 55,642,307 (GRCm39) missense probably damaging 0.98
R8193:Nfkbiz UTSW 16 55,642,214 (GRCm39) missense probably damaging 0.96
R8402:Nfkbiz UTSW 16 55,636,750 (GRCm39) missense probably damaging 0.98
R9222:Nfkbiz UTSW 16 55,634,347 (GRCm39) missense probably damaging 1.00
R9420:Nfkbiz UTSW 16 55,642,337 (GRCm39) missense probably damaging 0.99
Z1088:Nfkbiz UTSW 16 55,638,599 (GRCm39) missense probably damaging 1.00
Z1088:Nfkbiz UTSW 16 55,636,801 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTATGGAGGATCAGTTAGTAGACAG -3'
(R):5'- TTTCCTGGAATGGCCCTCTG -3'

Sequencing Primer
(F):5'- ACTTGTGCCTGAACTACGTC -3'
(R):5'- TATCGGGTGACACAGTTG -3'
Posted On 2022-06-15