Incidental Mutation 'R9457:Nfkbiz'
ID 714687
Institutional Source Beutler Lab
Gene Symbol Nfkbiz
Ensembl Gene ENSMUSG00000035356
Gene Name nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta
Synonyms Mail
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock # R9457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 55811375-55838899 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55813984 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 700 (V700E)
Ref Sequence ENSEMBL: ENSMUSP00000041173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036273] [ENSMUST00000096026] [ENSMUST00000114457] [ENSMUST00000114458]
AlphaFold Q9EST8
Predicted Effect probably damaging
Transcript: ENSMUST00000036273
AA Change: V700E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041173
Gene: ENSMUSG00000035356
AA Change: V700E

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096026
AA Change: V601E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093726
Gene: ENSMUSG00000035356
AA Change: V601E

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114457
AA Change: V601E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110101
Gene: ENSMUSG00000035356
AA Change: V601E

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114458
AA Change: V700E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110102
Gene: ENSMUSG00000035356
AA Change: V700E

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Meta Mutation Damage Score 0.6201 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ankyrin-repeat family and is induced by lipopolysaccharide (LPS). The C-terminal portion of the encoded product which contains the ankyrin repeats, shares high sequence similarity with the I kappa B family of proteins. The latter are known to play a role in inflammatory responses to LPS by their interaction with NF-B proteins through ankyrin-repeat domains. Studies in mouse indicate that this gene product is one of the nuclear I kappa B proteins and an activator of IL-6 production. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene may lead to background sensitive prenatal lethality and results in abnormal cytokine secretion, higher IgE levels, ocular surface and perioral skin inflammation accompanied by hair loss, and severe atopic dermatitis-like skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,179,246 H181R probably benign Het
4930404N11Rik C A 10: 81,365,777 V4L probably benign Het
4930430A15Rik A T 2: 111,170,286 M196K unknown Het
4932415D10Rik A G 10: 82,286,739 V3479A probably benign Het
A930009A15Rik T C 10: 115,578,331 L54P unknown Het
Ablim3 A G 18: 61,845,849 S204P probably benign Het
Acadl A G 1: 66,853,241 V141A probably benign Het
Ace3 A G 11: 105,994,861 D31G probably benign Het
Adam11 T G 11: 102,769,898 V85G probably benign Het
Adarb1 A T 10: 77,322,148 M155K possibly damaging Het
Arhgap10 G A 8: 77,384,786 T376M probably benign Het
Bod1l G T 5: 41,821,967 T668K probably damaging Het
Ccdc87 A G 19: 4,841,631 E717G probably damaging Het
Cdh17 T A 4: 11,771,329 I37N probably damaging Het
Cfap99 T G 5: 34,301,397 F45L probably benign Het
Chsy1 C A 7: 66,172,400 H794Q probably benign Het
Clec4a3 G A 6: 122,954,086 V45I probably benign Het
Clic3 G A 2: 25,457,718 V32I probably benign Het
Clip2 A T 5: 134,502,730 D740E probably benign Het
Col5a2 C T 1: 45,386,844 V1062I probably benign Het
Col5a2 A G 1: 45,392,813 probably null Het
Cyp2j11 C T 4: 96,307,359 V367I probably damaging Het
Ddr1 C T 17: 35,682,758 A821T possibly damaging Het
Dna2 G A 10: 62,950,793 E107K probably benign Het
Eif3d A G 15: 77,959,694 V484A probably benign Het
Fgfr4 A G 13: 55,161,127 T354A probably benign Het
Fkbp6 T C 5: 135,349,632 D54G probably benign Het
Gm4787 T A 12: 81,379,246 E46V probably damaging Het
Gm47995 A G 1: 151,198,475 T10A possibly damaging Het
Gm498 T C 7: 143,883,976 V137A possibly damaging Het
Gnb1l T A 16: 18,540,995 I50N probably damaging Het
Gphb5 A T 12: 75,415,749 V22D probably damaging Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Hmces T C 6: 87,933,274 V222A possibly damaging Het
Kat14 T A 2: 144,373,782 D62E probably benign Het
Kcnmb2 T A 3: 32,181,869 V89E probably benign Het
Kif23 T A 9: 61,944,225 N63I probably benign Het
Lamc2 T C 1: 153,139,854 M578V probably benign Het
Ltbp2 A T 12: 84,789,153 C1335S probably benign Het
Lyst A G 13: 13,687,745 E2622G possibly damaging Het
Mctp1 A T 13: 76,384,674 H47L probably benign Het
Micalcl A G 7: 112,411,458 K618R probably damaging Het
Mllt6 T C 11: 97,665,760 I92T probably benign Het
Morc2a A G 11: 3,676,184 I223V probably benign Het
Msh3 A T 13: 92,345,086 I306N probably benign Het
Myo3b T A 2: 70,095,209 S35T probably benign Het
Oit3 T A 10: 59,441,683 M1L unknown Het
Olfr1048 A T 2: 86,236,472 I114K probably damaging Het
Olfr1231 A T 2: 89,302,731 I287N probably damaging Het
Olfr606 T A 7: 103,451,411 F25I probably benign Het
Peg3 T G 7: 6,707,999 D1408A probably damaging Het
Plaa A C 4: 94,586,883 S201R possibly damaging Het
Psmd5 A G 2: 34,854,326 S395P probably benign Het
Ralgapa2 T C 2: 146,334,554 I1701V probably damaging Het
Rnf32 G A 5: 29,206,186 A157T probably damaging Het
Rrad T A 8: 104,629,727 probably null Het
Samm50 T A 15: 84,207,841 L339Q probably damaging Het
Scin T C 12: 40,104,958 E212G possibly damaging Het
Scrib T C 15: 76,067,299 D146G probably damaging Het
Slc19a1 G A 10: 77,049,771 D502N probably benign Het
Slc4a4 T C 5: 89,214,573 S839P probably damaging Het
Slc4a8 A G 15: 100,806,260 D764G probably damaging Het
Slc6a19 G A 13: 73,681,765 A590V probably damaging Het
Slfn8 G T 11: 83,017,706 H4N probably benign Het
Smad9 T A 3: 54,789,335 F274I possibly damaging Het
Snx4 A G 16: 33,286,010 E271G probably benign Het
Thap4 G A 1: 93,750,306 R253* probably null Het
Tmem65 T A 15: 58,790,179 I144F Het
Tnrc6a G A 7: 123,179,735 R1223Q probably benign Het
Traf7 CA CAA 17: 24,527,763 probably benign Het
Trpm2 T C 10: 77,911,392 Y1424C possibly damaging Het
Trrap T A 5: 144,826,668 Y2457N probably damaging Het
Vmn1r7 A G 6: 57,024,523 S251P probably damaging Het
Vmn2r89 A T 14: 51,456,012 E273V probably damaging Het
Vps52 A G 17: 33,962,182 D466G probably damaging Het
Xirp2 T C 2: 67,515,632 V2739A probably benign Het
Zc3h4 C T 7: 16,434,750 S1003F unknown Het
Zyg11a A T 4: 108,217,905 H6Q probably damaging Het
Other mutations in Nfkbiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nfkbiz APN 16 55817909 missense probably benign
IGL01324:Nfkbiz APN 16 55815804 missense probably damaging 1.00
IGL02086:Nfkbiz APN 16 55815671 missense probably damaging 1.00
IGL02627:Nfkbiz APN 16 55816351 missense probably damaging 1.00
IGL02740:Nfkbiz APN 16 55817954 missense probably benign
R0349:Nfkbiz UTSW 16 55818991 critical splice donor site probably null
R0539:Nfkbiz UTSW 16 55817879 missense probably benign 0.08
R0827:Nfkbiz UTSW 16 55816367 missense probably damaging 1.00
R1403:Nfkbiz UTSW 16 55816470 splice site probably benign
R1743:Nfkbiz UTSW 16 55816394 missense possibly damaging 0.82
R2090:Nfkbiz UTSW 16 55816455 missense probably benign 0.01
R2163:Nfkbiz UTSW 16 55818218 missense probably benign 0.00
R3195:Nfkbiz UTSW 16 55819628 missense probably damaging 1.00
R3974:Nfkbiz UTSW 16 55818436 missense probably benign 0.42
R4513:Nfkbiz UTSW 16 55816841 missense probably benign 0.20
R4765:Nfkbiz UTSW 16 55819024 critical splice acceptor site probably null
R4864:Nfkbiz UTSW 16 55818424 missense probably damaging 1.00
R5134:Nfkbiz UTSW 16 55818500 missense probably damaging 1.00
R5265:Nfkbiz UTSW 16 55819641 missense probably damaging 1.00
R5510:Nfkbiz UTSW 16 55814020 missense probably damaging 1.00
R6327:Nfkbiz UTSW 16 55821962 missense probably damaging 1.00
R7083:Nfkbiz UTSW 16 55818300 missense possibly damaging 0.88
R7369:Nfkbiz UTSW 16 55821846 missense probably damaging 1.00
R7650:Nfkbiz UTSW 16 55817839 missense probably benign 0.34
R7941:Nfkbiz UTSW 16 55821944 missense probably damaging 0.98
R8193:Nfkbiz UTSW 16 55821851 missense probably damaging 0.96
R8402:Nfkbiz UTSW 16 55816387 missense probably damaging 0.98
R9222:Nfkbiz UTSW 16 55813984 missense probably damaging 1.00
R9420:Nfkbiz UTSW 16 55821974 missense probably damaging 0.99
Z1088:Nfkbiz UTSW 16 55816438 missense probably damaging 1.00
Z1088:Nfkbiz UTSW 16 55818236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTATGGAGGATCAGTTAGTAGACAG -3'
(R):5'- TTTCCTGGAATGGCCCTCTG -3'

Sequencing Primer
(F):5'- ACTTGTGCCTGAACTACGTC -3'
(R):5'- TATCGGGTGACACAGTTG -3'
Posted On 2022-06-15