Incidental Mutation 'R0767:Pfkp'
ID71469
Institutional Source Beutler Lab
Gene Symbol Pfkp
Ensembl Gene ENSMUSG00000021196
Gene Namephosphofructokinase, platelet
Synonyms9330125N24Rik, 1200015H23Rik, PFK-C
MMRRC Submission 038947-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R0767 (G1)
Quality Score219
Status Not validated
Chromosome13
Chromosomal Location6579768-6648777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6605012 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 344 (V344M)
Ref Sequence ENSEMBL: ENSMUSP00000117030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021614] [ENSMUST00000138703]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021614
AA Change: V344M

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021614
Gene: ENSMUSG00000021196
AA Change: V344M

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 25 332 4.7e-114 PFAM
Pfam:PFK 411 696 1.2e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138703
AA Change: V344M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117030
Gene: ENSMUSG00000021196
AA Change: V344M

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 24 334 6.7e-136 PFAM
Pfam:PFK 410 698 1.1e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151894
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphofructokinase A protein family. The encoded enzyme is the platelet-specific isoform of phosphofructokinase and plays a key role in glycolysis regulation. This gene may play a role in metabolic reprogramming in some cancers, including clear cell renal cell carcinomas, and cancer of the bladder, breast, and lung. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 4 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Kiz A T 2: 146,889,051 T154S probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Other mutations in Pfkp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Pfkp APN 13 6619550 missense probably damaging 1.00
IGL00983:Pfkp APN 13 6581567 missense probably damaging 1.00
IGL01099:Pfkp APN 13 6603390 splice site probably benign
IGL01825:Pfkp APN 13 6620978 missense probably damaging 1.00
IGL02164:Pfkp APN 13 6597915 missense probably damaging 1.00
IGL02331:Pfkp APN 13 6597960 missense probably benign 0.33
IGL02680:Pfkp APN 13 6600672 unclassified probably benign
IGL02852:Pfkp APN 13 6605023 missense possibly damaging 0.57
R0414:Pfkp UTSW 13 6593210 missense probably benign 0.03
R0542:Pfkp UTSW 13 6621992 nonsense probably null
R0612:Pfkp UTSW 13 6605634 critical splice donor site probably null
R1417:Pfkp UTSW 13 6605719 missense probably benign 0.00
R1534:Pfkp UTSW 13 6619538 missense probably damaging 1.00
R1612:Pfkp UTSW 13 6588589 missense probably damaging 1.00
R2278:Pfkp UTSW 13 6619209 unclassified probably null
R2919:Pfkp UTSW 13 6593243 missense probably damaging 0.98
R2996:Pfkp UTSW 13 6635930 missense probably benign 0.01
R4214:Pfkp UTSW 13 6619225 missense probably damaging 0.99
R4374:Pfkp UTSW 13 6620989 missense probably damaging 1.00
R4693:Pfkp UTSW 13 6600635 missense possibly damaging 0.91
R5534:Pfkp UTSW 13 6648583 missense probably damaging 1.00
R5537:Pfkp UTSW 13 6619242 missense probably damaging 1.00
R5619:Pfkp UTSW 13 6598729 unclassified probably benign
R5677:Pfkp UTSW 13 6588595 missense probably damaging 1.00
R6038:Pfkp UTSW 13 6597969 missense probably benign 0.14
R6038:Pfkp UTSW 13 6597969 missense probably benign 0.14
R6216:Pfkp UTSW 13 6619188 missense probably benign 0.00
R6330:Pfkp UTSW 13 6585250 unclassified probably benign
R6676:Pfkp UTSW 13 6586539 missense possibly damaging 0.74
R7044:Pfkp UTSW 13 6581567 missense probably damaging 1.00
R7146:Pfkp UTSW 13 6602781 missense probably benign 0.00
R7193:Pfkp UTSW 13 6593216 missense probably benign 0.00
R7588:Pfkp UTSW 13 6648637 missense possibly damaging 0.81
R7611:Pfkp UTSW 13 6605083 critical splice acceptor site probably null
R7821:Pfkp UTSW 13 6597872 missense probably damaging 1.00
Z1177:Pfkp UTSW 13 6619252 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AAGGCCACTTTAACCCAGTGCTC -3'
(R):5'- TGGCAGAACAGGATAGCCCCTTAC -3'

Sequencing Primer
(F):5'- TCACTGAGTCTGAAGCAGTC -3'
(R):5'- GGATAGCCCCTTACTGAATCATTG -3'
Posted On2013-09-30