Incidental Mutation 'R9458:Sgsm2'
ID 714717
Institutional Source Beutler Lab
Gene Symbol Sgsm2
Ensembl Gene ENSMUSG00000038351
Gene Name small G protein signaling modulator 2
Synonyms D630003G22Rik, Rutbc1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock # R9458 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 74849261-74897060 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74868731 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 102 (S102P)
Ref Sequence ENSEMBL: ENSMUSP00000050496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057631] [ENSMUST00000081799]
AlphaFold Q80U12
Predicted Effect possibly damaging
Transcript: ENSMUST00000057631
AA Change: S102P

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050496
Gene: ENSMUSG00000038351
AA Change: S102P

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 453 476 N/A INTRINSIC
TBC 563 965 3.57e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081799
AA Change: S102P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080489
Gene: ENSMUSG00000038351
AA Change: S102P

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 446 453 N/A INTRINSIC
low complexity region 498 521 N/A INTRINSIC
TBC 608 1010 3.57e-34 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator with activity towards RAB32 and RAB33B, which are regulators of membrane trafficking. The encoded protein inactivates RAB32 and can bind RAB9A-GTP, a protein required for RAB32 activation. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik T C 11: 70,236,905 I64V possibly damaging Het
4921539E11Rik T A 4: 103,284,411 I18L possibly damaging Het
Arcn1 A G 9: 44,759,970 S87P probably damaging Het
Bmp7 G A 2: 172,879,475 P269L possibly damaging Het
Clrn2 A T 5: 45,460,171 Y128F possibly damaging Het
Col2a1 G A 15: 97,978,361 R1192C unknown Het
Col6a6 A G 9: 105,709,162 F1887L probably benign Het
Crocc2 G T 1: 93,217,794 A1466S probably damaging Het
Dnah8 A G 17: 30,830,803 N4313D probably damaging Het
Dzip1 T C 14: 118,911,373 E298G probably damaging Het
Eif2b4 C A 5: 31,193,265 probably benign Het
Emx1 T A 6: 85,204,060 V253D probably damaging Het
Enah A T 1: 181,918,542 S654R unknown Het
F2 A T 2: 91,630,768 N207K probably benign Het
Flcn G T 11: 59,799,382 D281E possibly damaging Het
Fzd7 C A 1: 59,484,395 P479Q probably damaging Het
Gm281 A T 14: 13,856,709 F467L Het
Gm7534 G A 4: 134,202,001 P331L probably benign Het
Gulo T C 14: 65,997,594 N226S probably benign Het
Igfbp6 A G 15: 102,149,199 N205S probably benign Het
Ints1 A G 5: 139,757,652 L1655P probably damaging Het
Mndal A G 1: 173,860,183 F495S probably damaging Het
Panx2 A G 15: 89,067,854 K175E possibly damaging Het
Panx2 A C 15: 89,067,855 K175T probably damaging Het
Pde6a A T 18: 61,254,406 Y456F probably damaging Het
Phf21b A G 15: 84,854,794 L22P possibly damaging Het
Rev3l T C 10: 39,783,251 I83T probably damaging Het
Sfrp5 T C 19: 42,201,857 D52G probably benign Het
Slc7a2 T G 8: 40,899,293 I131S probably damaging Het
Snupn A T 9: 56,982,755 I287F possibly damaging Het
Synj1 T G 16: 90,969,312 I573L probably benign Het
Tmcc2 T G 1: 132,359,009 D568A probably damaging Het
Tmf1 G T 6: 97,176,421 H230Q probably benign Het
Togaram2 T C 17: 71,717,251 V810A possibly damaging Het
Vmn1r169 T C 7: 23,577,203 S7P possibly damaging Het
Vwce A G 19: 10,654,324 T550A possibly damaging Het
Zbtb12 T C 17: 34,896,391 V384A possibly damaging Het
Zscan20 T C 4: 128,586,846 probably null Het
Other mutations in Sgsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Sgsm2 APN 11 74853871 missense possibly damaging 0.91
IGL02164:Sgsm2 APN 11 74865416 missense possibly damaging 0.90
IGL02236:Sgsm2 APN 11 74859872 missense probably damaging 1.00
IGL02330:Sgsm2 APN 11 74858667 missense probably benign 0.01
IGL02352:Sgsm2 APN 11 74892074 splice site probably benign
IGL02359:Sgsm2 APN 11 74892074 splice site probably benign
IGL03061:Sgsm2 APN 11 74851136 missense probably damaging 1.00
IGL03180:Sgsm2 APN 11 74868575 critical splice donor site probably null
R0208:Sgsm2 UTSW 11 74868241 missense probably damaging 1.00
R0433:Sgsm2 UTSW 11 74858190 splice site probably null
R0517:Sgsm2 UTSW 11 74867651 missense possibly damaging 0.62
R0755:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R1439:Sgsm2 UTSW 11 74869138 missense probably benign 0.34
R1527:Sgsm2 UTSW 11 74853848 nonsense probably null
R1713:Sgsm2 UTSW 11 74896826 missense probably null 0.04
R1962:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R2189:Sgsm2 UTSW 11 74853082 missense probably damaging 1.00
R4259:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4261:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4408:Sgsm2 UTSW 11 74851766 missense probably damaging 0.99
R4590:Sgsm2 UTSW 11 74851132 missense probably damaging 1.00
R6137:Sgsm2 UTSW 11 74850851 missense probably damaging 1.00
R6162:Sgsm2 UTSW 11 74892021 missense probably damaging 1.00
R6457:Sgsm2 UTSW 11 74865169 missense possibly damaging 0.77
R6681:Sgsm2 UTSW 11 74865378 missense probably damaging 0.99
R6722:Sgsm2 UTSW 11 74865424 missense probably damaging 1.00
R6986:Sgsm2 UTSW 11 74892041 missense probably damaging 1.00
R7205:Sgsm2 UTSW 11 74854493 missense possibly damaging 0.88
R7209:Sgsm2 UTSW 11 74854325 missense probably damaging 0.98
R7655:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R7656:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R8526:Sgsm2 UTSW 11 74869021 missense probably benign 0.17
R9112:Sgsm2 UTSW 11 74865396 nonsense probably null
R9184:Sgsm2 UTSW 11 74892008 missense possibly damaging 0.63
R9226:Sgsm2 UTSW 11 74858134 missense possibly damaging 0.72
R9391:Sgsm2 UTSW 11 74853804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAACCATATAGAGGGATGAGGCTG -3'
(R):5'- GGCTAAAGGTGGCTTCCTTC -3'

Sequencing Primer
(F):5'- GCTGAGGTGGGCCAAGG -3'
(R):5'- CTAAAGGTGGCTTCCTTCGAGGG -3'
Posted On 2022-06-15