Mutagenetix > Incidental Mutation

Incidental Mutation 'R9458:Sgsm2'

714717

Institutional Source

Beutler Lab

Gene Symbol

Sgsm2

Ensembl Gene

ENSMUSG00000038351

Gene Name

small G protein signaling modulator 2

Synonyms

D630003G22Rik, Rutbc1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R9458 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74849261-74897060 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74868731 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 102 (S102P)

Ref Sequence

ENSEMBL: ENSMUSP00000050496 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057631] [ENSMUST00000081799]

AlphaFold

Q80U12

Predicted Effect

possibly damaging
Transcript: ENSMUST00000057631
AA Change: S102P

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000050496
Gene: ENSMUSG00000038351
AA Change: S102P

Domain	Start	End	E-Value	Type
RUN	128	188	4.3e-18	SMART
low complexity region	453	476	N/A	INTRINSIC
TBC	563	965	3.57e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000081799
AA Change: S102P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000080489
Gene: ENSMUSG00000038351
AA Change: S102P

Domain	Start	End	E-Value	Type
RUN	128	188	4.3e-18	SMART
low complexity region	446	453	N/A	INTRINSIC
low complexity region	498	521	N/A	INTRINSIC
TBC	608	1010	3.57e-34	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator with activity towards RAB32 and RAB33B, which are regulators of membrane trafficking. The encoded protein inactivates RAB32 and can bind RAB9A-GTP, a protein required for RAB32 activation. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010K14Rik	T	C	11: 70,236,905	I64V	possibly damaging	Het
4921539E11Rik	T	A	4: 103,284,411	I18L	possibly damaging	Het
Arcn1	A	G	9: 44,759,970	S87P	probably damaging	Het
Bmp7	G	A	2: 172,879,475	P269L	possibly damaging	Het
Clrn2	A	T	5: 45,460,171	Y128F	possibly damaging	Het
Col2a1	G	A	15: 97,978,361	R1192C	unknown	Het
Col6a6	A	G	9: 105,709,162	F1887L	probably benign	Het
Crocc2	G	T	1: 93,217,794	A1466S	probably damaging	Het
Dnah8	A	G	17: 30,830,803	N4313D	probably damaging	Het
Dzip1	T	C	14: 118,911,373	E298G	probably damaging	Het
Eif2b4	C	A	5: 31,193,265		probably benign	Het
Emx1	T	A	6: 85,204,060	V253D	probably damaging	Het
Enah	A	T	1: 181,918,542	S654R	unknown	Het
F2	A	T	2: 91,630,768	N207K	probably benign	Het
Flcn	G	T	11: 59,799,382	D281E	possibly damaging	Het
Fzd7	C	A	1: 59,484,395	P479Q	probably damaging	Het
Gm281	A	T	14: 13,856,709	F467L		Het
Gm7534	G	A	4: 134,202,001	P331L	probably benign	Het
Gulo	T	C	14: 65,997,594	N226S	probably benign	Het
Igfbp6	A	G	15: 102,149,199	N205S	probably benign	Het
Ints1	A	G	5: 139,757,652	L1655P	probably damaging	Het
Mndal	A	G	1: 173,860,183	F495S	probably damaging	Het
Panx2	A	G	15: 89,067,854	K175E	possibly damaging	Het
Panx2	A	C	15: 89,067,855	K175T	probably damaging	Het
Pde6a	A	T	18: 61,254,406	Y456F	probably damaging	Het
Phf21b	A	G	15: 84,854,794	L22P	possibly damaging	Het
Rev3l	T	C	10: 39,783,251	I83T	probably damaging	Het
Sfrp5	T	C	19: 42,201,857	D52G	probably benign	Het
Slc7a2	T	G	8: 40,899,293	I131S	probably damaging	Het
Snupn	A	T	9: 56,982,755	I287F	possibly damaging	Het
Synj1	T	G	16: 90,969,312	I573L	probably benign	Het
Tmcc2	T	G	1: 132,359,009	D568A	probably damaging	Het
Tmf1	G	T	6: 97,176,421	H230Q	probably benign	Het
Togaram2	T	C	17: 71,717,251	V810A	possibly damaging	Het
Vmn1r169	T	C	7: 23,577,203	S7P	possibly damaging	Het
Vwce	A	G	19: 10,654,324	T550A	possibly damaging	Het
Zbtb12	T	C	17: 34,896,391	V384A	possibly damaging	Het
Zscan20	T	C	4: 128,586,846		probably null	Het

Other mutations in Sgsm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Sgsm2	APN	11	74853871	missense	possibly damaging	0.91
IGL02164:Sgsm2	APN	11	74865416	missense	possibly damaging	0.90
IGL02236:Sgsm2	APN	11	74859872	missense	probably damaging	1.00
IGL02330:Sgsm2	APN	11	74858667	missense	probably benign	0.01
IGL02352:Sgsm2	APN	11	74892074	splice site	probably benign
IGL02359:Sgsm2	APN	11	74892074	splice site	probably benign
IGL03061:Sgsm2	APN	11	74851136	missense	probably damaging	1.00
IGL03180:Sgsm2	APN	11	74868575	critical splice donor site	probably null
R0208:Sgsm2	UTSW	11	74868241	missense	probably damaging	1.00
R0433:Sgsm2	UTSW	11	74858190	splice site	probably null
R0517:Sgsm2	UTSW	11	74867651	missense	possibly damaging	0.62
R0755:Sgsm2	UTSW	11	74865497	missense	probably damaging	1.00
R1439:Sgsm2	UTSW	11	74869138	missense	probably benign	0.34
R1527:Sgsm2	UTSW	11	74853848	nonsense	probably null
R1713:Sgsm2	UTSW	11	74896826	missense	probably null	0.04
R1962:Sgsm2	UTSW	11	74892028	missense	probably damaging	1.00
R2189:Sgsm2	UTSW	11	74853082	missense	probably damaging	1.00
R4259:Sgsm2	UTSW	11	74892028	missense	probably damaging	1.00
R4261:Sgsm2	UTSW	11	74892028	missense	probably damaging	1.00
R4408:Sgsm2	UTSW	11	74851766	missense	probably damaging	0.99
R4590:Sgsm2	UTSW	11	74851132	missense	probably damaging	1.00
R6137:Sgsm2	UTSW	11	74850851	missense	probably damaging	1.00
R6162:Sgsm2	UTSW	11	74892021	missense	probably damaging	1.00
R6457:Sgsm2	UTSW	11	74865169	missense	possibly damaging	0.77
R6681:Sgsm2	UTSW	11	74865378	missense	probably damaging	0.99
R6722:Sgsm2	UTSW	11	74865424	missense	probably damaging	1.00
R6986:Sgsm2	UTSW	11	74892041	missense	probably damaging	1.00
R7205:Sgsm2	UTSW	11	74854493	missense	possibly damaging	0.88
R7209:Sgsm2	UTSW	11	74854325	missense	probably damaging	0.98
R7655:Sgsm2	UTSW	11	74865497	missense	probably damaging	1.00
R7656:Sgsm2	UTSW	11	74865497	missense	probably damaging	1.00
R8526:Sgsm2	UTSW	11	74869021	missense	probably benign	0.17
R9112:Sgsm2	UTSW	11	74865396	nonsense	probably null
R9184:Sgsm2	UTSW	11	74892008	missense	possibly damaging	0.63
R9226:Sgsm2	UTSW	11	74858134	missense	possibly damaging	0.72
R9391:Sgsm2	UTSW	11	74853804	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTAACCATATAGAGGGATGAGGCTG -3'
(R):5'- GGCTAAAGGTGGCTTCCTTC -3'

Sequencing Primer
(F):5'- GCTGAGGTGGGCCAAGG -3'
(R):5'- CTAAAGGTGGCTTCCTTCGAGGG -3'

Posted On

2022-06-15