Incidental Mutation 'R9459:Mybl1'
ID 714733
Institutional Source Beutler Lab
Gene Symbol Mybl1
Ensembl Gene ENSMUSG00000025912
Gene Name myeloblastosis oncogene-like 1
Synonyms G1-419-6, A-myb, repro9
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.561) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 9737640-9770434 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9746484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 392 (V392A)
Ref Sequence ENSEMBL: ENSMUSP00000086034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088658] [ENSMUST00000115468]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000088658
AA Change: V392A

PolyPhen 2 Score 0.859 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000086034
Gene: ENSMUSG00000025912
AA Change: V392A

DomainStartEndE-ValueType
SANT 34 83 1.08e-18 SMART
SANT 86 135 1.26e-19 SMART
SANT 138 186 1.75e-18 SMART
Pfam:LMSTEN 240 285 1.2e-29 PFAM
Pfam:Cmyb_C 485 648 6.9e-82 PFAM
low complexity region 734 749 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115468
AA Change: V392A

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111128
Gene: ENSMUSG00000025912
AA Change: V392A

DomainStartEndE-ValueType
SANT 34 83 1.08e-18 SMART
SANT 86 135 1.26e-19 SMART
SANT 138 186 1.75e-18 SMART
Pfam:LMSTEN 239 285 1.9e-30 PFAM
Pfam:Cmyb_C 485 651 4.1e-74 PFAM
low complexity region 674 689 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes show growth retardation after birth and an impairment of serum antibody response. Male mutant mice are sterile due to a meiotic defect. While female mutant mice are fertile, breast development is impaired after pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,735,414 (GRCm39) probably null Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Aox3 A G 1: 58,189,468 (GRCm39) I390V probably benign Het
Ap3b2 T C 7: 81,123,651 (GRCm39) N400S probably benign Het
Baalc A T 15: 38,797,419 (GRCm39) N70I probably benign Het
Brca2 T A 5: 150,464,094 (GRCm39) V1286D probably damaging Het
Ccdc30 T C 4: 119,234,470 (GRCm39) R81G possibly damaging Het
Cd209g T C 8: 4,185,610 (GRCm39) S15P probably benign Het
Chrnb3 G A 8: 27,883,884 (GRCm39) W207* probably null Het
Cmpk2 C T 12: 26,528,022 (GRCm39) T413M probably damaging Het
Coq4 T A 2: 29,678,562 (GRCm39) Y63N probably damaging Het
Depdc5 T A 5: 33,148,117 (GRCm39) S1478T probably damaging Het
Etf1 A G 18: 35,039,134 (GRCm39) F378L probably benign Het
Exoc6 T C 19: 37,574,341 (GRCm39) V324A probably benign Het
Frem2 A G 3: 53,560,907 (GRCm39) L1200P probably benign Het
Gadl1 T C 9: 115,794,679 (GRCm39) W285R probably damaging Het
Gbp3 A G 3: 142,270,707 (GRCm39) probably null Het
Gm14295 C T 2: 176,499,165 (GRCm39) T5I possibly damaging Het
Hps4 T C 5: 112,522,875 (GRCm39) S578P probably benign Het
Kctd13 T A 7: 126,544,254 (GRCm39) D317E probably damaging Het
Kdm4b T A 17: 56,706,509 (GRCm39) D881E probably benign Het
Klf10 G A 15: 38,296,171 (GRCm39) P473L probably damaging Het
Lrch3 A T 16: 32,799,775 (GRCm39) D371V probably damaging Het
Msh2 T C 17: 87,985,758 (GRCm39) S112P possibly damaging Het
Msh3 A G 13: 92,352,047 (GRCm39) V1036A possibly damaging Het
Myo7a T C 7: 97,722,380 (GRCm39) I1182V possibly damaging Het
Nectin1 A C 9: 43,715,090 (GRCm39) E442A probably benign Het
Nscme3l T A 19: 5,553,757 (GRCm39) H8L probably benign Het
Obsl1 G T 1: 75,474,884 (GRCm39) H839N probably benign Het
Or4c105 T C 2: 88,647,967 (GRCm39) F151L probably benign Het
Or9i1b T C 19: 13,896,674 (GRCm39) C97R possibly damaging Het
Pacs1 C T 19: 5,195,098 (GRCm39) probably null Het
Pcdh17 G T 14: 84,686,063 (GRCm39) E843D probably benign Het
Pcnt A G 10: 76,228,572 (GRCm39) L1531P probably damaging Het
Pdgfra A G 5: 75,353,129 (GRCm39) D973G probably damaging Het
Pkd2 A G 5: 104,614,800 (GRCm39) Y214C probably damaging Het
Plcb1 T C 2: 135,164,558 (GRCm39) Y427H probably benign Het
Ppm1h A G 10: 122,743,482 (GRCm39) N402S possibly damaging Het
Rassf4 T A 6: 116,618,749 (GRCm39) probably null Het
Ryr1 G A 7: 28,768,068 (GRCm39) T2856I probably damaging Het
Serpinb8 A T 1: 107,533,520 (GRCm39) K192* probably null Het
Slfn14 T G 11: 83,170,198 (GRCm39) Q482P possibly damaging Het
Spata2 A G 2: 167,327,205 (GRCm39) V64A probably benign Het
Tax1bp1 T G 6: 52,706,314 (GRCm39) V105G probably damaging Het
Tbc1d22a T G 15: 86,120,021 (GRCm39) S142A possibly damaging Het
Tdrd9 T C 12: 111,992,007 (GRCm39) F594S probably damaging Het
Uba3 T C 6: 97,166,559 (GRCm39) I281V probably benign Het
Uggt2 T C 14: 119,286,595 (GRCm39) E723G probably benign Het
Usp20 C T 2: 30,901,024 (GRCm39) S391F probably damaging Het
Usp24 T A 4: 106,199,555 (GRCm39) D166E probably damaging Het
Vmn1r1 A G 1: 181,985,503 (GRCm39) V54A probably benign Het
Zfp442 T A 2: 150,250,668 (GRCm39) E411D unknown Het
Zfp804a T C 2: 82,089,753 (GRCm39) I1194T probably damaging Het
Other mutations in Mybl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Mybl1 APN 1 9,741,904 (GRCm39) missense probably damaging 1.00
IGL01431:Mybl1 APN 1 9,742,872 (GRCm39) missense probably damaging 0.97
IGL01733:Mybl1 APN 1 9,755,935 (GRCm39) missense possibly damaging 0.94
IGL01903:Mybl1 APN 1 9,741,801 (GRCm39) splice site probably null
IGL02527:Mybl1 APN 1 9,760,373 (GRCm39) missense probably damaging 0.99
IGL02729:Mybl1 APN 1 9,742,795 (GRCm39) missense probably benign 0.22
IGL02810:Mybl1 APN 1 9,748,613 (GRCm39) missense probably benign
IGL02810:Mybl1 APN 1 9,743,340 (GRCm39) missense probably damaging 1.00
IGL03369:Mybl1 APN 1 9,742,780 (GRCm39) missense probably damaging 0.99
R0696:Mybl1 UTSW 1 9,743,373 (GRCm39) missense probably damaging 1.00
R1453:Mybl1 UTSW 1 9,741,901 (GRCm39) missense probably benign 0.27
R1476:Mybl1 UTSW 1 9,742,886 (GRCm39) splice site probably null
R1567:Mybl1 UTSW 1 9,755,976 (GRCm39) missense probably damaging 1.00
R3110:Mybl1 UTSW 1 9,752,095 (GRCm39) missense probably damaging 1.00
R3112:Mybl1 UTSW 1 9,752,095 (GRCm39) missense probably damaging 1.00
R3438:Mybl1 UTSW 1 9,757,870 (GRCm39) missense probably damaging 1.00
R3801:Mybl1 UTSW 1 9,743,439 (GRCm39) missense probably damaging 1.00
R4333:Mybl1 UTSW 1 9,742,523 (GRCm39) missense probably damaging 1.00
R4646:Mybl1 UTSW 1 9,742,511 (GRCm39) missense probably damaging 1.00
R4705:Mybl1 UTSW 1 9,760,340 (GRCm39) missense probably damaging 0.99
R5873:Mybl1 UTSW 1 9,755,890 (GRCm39) missense possibly damaging 0.75
R6326:Mybl1 UTSW 1 9,748,732 (GRCm39) critical splice acceptor site probably null
R6444:Mybl1 UTSW 1 9,755,917 (GRCm39) missense possibly damaging 0.93
R6801:Mybl1 UTSW 1 9,753,353 (GRCm39) missense probably benign 0.42
R7168:Mybl1 UTSW 1 9,748,513 (GRCm39) missense probably damaging 1.00
R8322:Mybl1 UTSW 1 9,746,506 (GRCm39) missense probably damaging 1.00
R9369:Mybl1 UTSW 1 9,742,829 (GRCm39) missense probably damaging 1.00
Z1176:Mybl1 UTSW 1 9,755,994 (GRCm39) missense probably damaging 0.99
Z1177:Mybl1 UTSW 1 9,746,265 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAAGTGAGCCATCGCCAAG -3'
(R):5'- AGACAAAGCTTGCTTTTACTGG -3'

Sequencing Primer
(F):5'- AAGCTCACTGCCTGCAGACTG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On 2022-06-15