Incidental Mutation 'R9459:Aox3'
ID 714734
Institutional Source Beutler Lab
Gene Symbol Aox3
Ensembl Gene ENSMUSG00000064294
Gene Name aldehyde oxidase 3
Synonyms 1200011D03Rik, AOH1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 58152289-58239857 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58189468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 390 (I390V)
Ref Sequence ENSEMBL: ENSMUSP00000049391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040999]
AlphaFold G3X982
PDB Structure Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000040999
AA Change: I390V

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: I390V

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.4e-9 PFAM
Pfam:Fer2_2 91 165 1e-29 PFAM
Pfam:FAD_binding_5 239 419 1e-44 PFAM
CO_deh_flav_C 426 530 9.26e-24 SMART
Ald_Xan_dh_C 594 697 2.27e-41 SMART
Pfam:Ald_Xan_dh_C2 708 1241 8.7e-183 PFAM
low complexity region 1275 1286 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,735,414 (GRCm39) probably null Het
Alms1 T A 6: 85,604,946 (GRCm39) C2199S probably damaging Het
Ap3b2 T C 7: 81,123,651 (GRCm39) N400S probably benign Het
Baalc A T 15: 38,797,419 (GRCm39) N70I probably benign Het
Brca2 T A 5: 150,464,094 (GRCm39) V1286D probably damaging Het
Ccdc30 T C 4: 119,234,470 (GRCm39) R81G possibly damaging Het
Cd209g T C 8: 4,185,610 (GRCm39) S15P probably benign Het
Chrnb3 G A 8: 27,883,884 (GRCm39) W207* probably null Het
Cmpk2 C T 12: 26,528,022 (GRCm39) T413M probably damaging Het
Coq4 T A 2: 29,678,562 (GRCm39) Y63N probably damaging Het
Depdc5 T A 5: 33,148,117 (GRCm39) S1478T probably damaging Het
Etf1 A G 18: 35,039,134 (GRCm39) F378L probably benign Het
Exoc6 T C 19: 37,574,341 (GRCm39) V324A probably benign Het
Frem2 A G 3: 53,560,907 (GRCm39) L1200P probably benign Het
Gadl1 T C 9: 115,794,679 (GRCm39) W285R probably damaging Het
Gbp3 A G 3: 142,270,707 (GRCm39) probably null Het
Gm14295 C T 2: 176,499,165 (GRCm39) T5I possibly damaging Het
Hps4 T C 5: 112,522,875 (GRCm39) S578P probably benign Het
Kctd13 T A 7: 126,544,254 (GRCm39) D317E probably damaging Het
Kdm4b T A 17: 56,706,509 (GRCm39) D881E probably benign Het
Klf10 G A 15: 38,296,171 (GRCm39) P473L probably damaging Het
Lrch3 A T 16: 32,799,775 (GRCm39) D371V probably damaging Het
Msh2 T C 17: 87,985,758 (GRCm39) S112P possibly damaging Het
Msh3 A G 13: 92,352,047 (GRCm39) V1036A possibly damaging Het
Mybl1 A G 1: 9,746,484 (GRCm39) V392A possibly damaging Het
Myo7a T C 7: 97,722,380 (GRCm39) I1182V possibly damaging Het
Nectin1 A C 9: 43,715,090 (GRCm39) E442A probably benign Het
Nscme3l T A 19: 5,553,757 (GRCm39) H8L probably benign Het
Obsl1 G T 1: 75,474,884 (GRCm39) H839N probably benign Het
Or4c105 T C 2: 88,647,967 (GRCm39) F151L probably benign Het
Or9i1b T C 19: 13,896,674 (GRCm39) C97R possibly damaging Het
Pacs1 C T 19: 5,195,098 (GRCm39) probably null Het
Pcdh17 G T 14: 84,686,063 (GRCm39) E843D probably benign Het
Pcnt A G 10: 76,228,572 (GRCm39) L1531P probably damaging Het
Pdgfra A G 5: 75,353,129 (GRCm39) D973G probably damaging Het
Pkd2 A G 5: 104,614,800 (GRCm39) Y214C probably damaging Het
Plcb1 T C 2: 135,164,558 (GRCm39) Y427H probably benign Het
Ppm1h A G 10: 122,743,482 (GRCm39) N402S possibly damaging Het
Rassf4 T A 6: 116,618,749 (GRCm39) probably null Het
Ryr1 G A 7: 28,768,068 (GRCm39) T2856I probably damaging Het
Serpinb8 A T 1: 107,533,520 (GRCm39) K192* probably null Het
Slfn14 T G 11: 83,170,198 (GRCm39) Q482P possibly damaging Het
Spata2 A G 2: 167,327,205 (GRCm39) V64A probably benign Het
Tax1bp1 T G 6: 52,706,314 (GRCm39) V105G probably damaging Het
Tbc1d22a T G 15: 86,120,021 (GRCm39) S142A possibly damaging Het
Tdrd9 T C 12: 111,992,007 (GRCm39) F594S probably damaging Het
Uba3 T C 6: 97,166,559 (GRCm39) I281V probably benign Het
Uggt2 T C 14: 119,286,595 (GRCm39) E723G probably benign Het
Usp20 C T 2: 30,901,024 (GRCm39) S391F probably damaging Het
Usp24 T A 4: 106,199,555 (GRCm39) D166E probably damaging Het
Vmn1r1 A G 1: 181,985,503 (GRCm39) V54A probably benign Het
Zfp442 T A 2: 150,250,668 (GRCm39) E411D unknown Het
Zfp804a T C 2: 82,089,753 (GRCm39) I1194T probably damaging Het
Other mutations in Aox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Aox3 APN 1 58,208,953 (GRCm39) missense probably damaging 1.00
IGL01747:Aox3 APN 1 58,198,817 (GRCm39) missense probably damaging 0.97
IGL01883:Aox3 APN 1 58,177,442 (GRCm39) missense probably damaging 1.00
IGL01911:Aox3 APN 1 58,191,719 (GRCm39) missense probably benign 0.04
IGL02017:Aox3 APN 1 58,160,151 (GRCm39) missense probably damaging 1.00
IGL02120:Aox3 APN 1 58,166,809 (GRCm39) missense probably benign 0.00
IGL02466:Aox3 APN 1 58,197,431 (GRCm39) missense probably benign 0.28
IGL02545:Aox3 APN 1 58,222,645 (GRCm39) missense probably damaging 1.00
IGL02572:Aox3 APN 1 58,197,526 (GRCm39) missense probably damaging 1.00
IGL02746:Aox3 APN 1 58,222,701 (GRCm39) missense possibly damaging 0.83
IGL02808:Aox3 APN 1 58,181,859 (GRCm39) missense probably damaging 0.99
IGL02812:Aox3 APN 1 58,205,055 (GRCm39) missense probably benign 0.00
IGL02982:Aox3 APN 1 58,166,846 (GRCm39) missense probably benign 0.00
IGL03056:Aox3 APN 1 58,198,180 (GRCm39) critical splice donor site probably null
IGL03182:Aox3 APN 1 58,205,046 (GRCm39) missense probably benign 0.02
IGL03234:Aox3 APN 1 58,191,845 (GRCm39) missense probably benign
IGL03374:Aox3 APN 1 58,211,007 (GRCm39) missense probably damaging 1.00
amber UTSW 1 58,211,050 (GRCm39) nonsense probably null
R0071:Aox3 UTSW 1 58,211,050 (GRCm39) nonsense probably null
R0071:Aox3 UTSW 1 58,211,050 (GRCm39) nonsense probably null
R0135:Aox3 UTSW 1 58,164,247 (GRCm39) splice site probably benign
R0332:Aox3 UTSW 1 58,181,910 (GRCm39) missense probably benign 0.00
R0626:Aox3 UTSW 1 58,211,458 (GRCm39) missense possibly damaging 0.94
R1325:Aox3 UTSW 1 58,215,726 (GRCm39) nonsense probably null
R1435:Aox3 UTSW 1 58,202,605 (GRCm39) critical splice donor site probably null
R1438:Aox3 UTSW 1 58,192,337 (GRCm39) missense probably benign
R1567:Aox3 UTSW 1 58,233,852 (GRCm39) missense probably damaging 0.96
R1575:Aox3 UTSW 1 58,191,713 (GRCm39) missense probably benign 0.04
R1759:Aox3 UTSW 1 58,209,805 (GRCm39) splice site probably null
R1785:Aox3 UTSW 1 58,209,002 (GRCm39) missense probably damaging 1.00
R1786:Aox3 UTSW 1 58,209,002 (GRCm39) missense probably damaging 1.00
R1921:Aox3 UTSW 1 58,219,810 (GRCm39) missense probably damaging 1.00
R1984:Aox3 UTSW 1 58,192,220 (GRCm39) missense possibly damaging 0.88
R2012:Aox3 UTSW 1 58,177,391 (GRCm39) missense probably benign 0.02
R2080:Aox3 UTSW 1 58,225,439 (GRCm39) missense probably benign 0.06
R2121:Aox3 UTSW 1 58,191,708 (GRCm39) splice site probably benign
R2126:Aox3 UTSW 1 58,197,375 (GRCm39) missense probably benign 0.25
R2130:Aox3 UTSW 1 58,209,002 (GRCm39) missense probably damaging 1.00
R2131:Aox3 UTSW 1 58,209,002 (GRCm39) missense probably damaging 1.00
R2132:Aox3 UTSW 1 58,209,002 (GRCm39) missense probably damaging 1.00
R2133:Aox3 UTSW 1 58,209,002 (GRCm39) missense probably damaging 1.00
R2385:Aox3 UTSW 1 58,177,448 (GRCm39) missense probably damaging 1.00
R2495:Aox3 UTSW 1 58,227,567 (GRCm39) missense probably damaging 0.99
R4200:Aox3 UTSW 1 58,227,537 (GRCm39) missense probably damaging 1.00
R4231:Aox3 UTSW 1 58,154,044 (GRCm39) missense probably benign 0.12
R4591:Aox3 UTSW 1 58,191,815 (GRCm39) missense probably damaging 0.99
R4627:Aox3 UTSW 1 58,164,194 (GRCm39) missense probably damaging 0.98
R4831:Aox3 UTSW 1 58,191,725 (GRCm39) missense probably damaging 0.97
R4864:Aox3 UTSW 1 58,215,646 (GRCm39) missense probably damaging 1.00
R4976:Aox3 UTSW 1 58,227,683 (GRCm39) critical splice donor site probably null
R5007:Aox3 UTSW 1 58,202,583 (GRCm39) missense probably benign
R5119:Aox3 UTSW 1 58,227,683 (GRCm39) critical splice donor site probably null
R5175:Aox3 UTSW 1 58,211,487 (GRCm39) missense probably benign 0.01
R5360:Aox3 UTSW 1 58,185,667 (GRCm39) missense probably damaging 1.00
R5784:Aox3 UTSW 1 58,192,658 (GRCm39) missense probably benign 0.00
R6050:Aox3 UTSW 1 58,219,814 (GRCm39) missense possibly damaging 0.93
R6056:Aox3 UTSW 1 58,209,018 (GRCm39) missense probably damaging 1.00
R6162:Aox3 UTSW 1 58,198,890 (GRCm39) missense possibly damaging 0.75
R6181:Aox3 UTSW 1 58,198,105 (GRCm39) missense probably benign 0.03
R6374:Aox3 UTSW 1 58,211,320 (GRCm39) missense probably benign 0.11
R6662:Aox3 UTSW 1 58,157,774 (GRCm39) missense probably damaging 1.00
R6809:Aox3 UTSW 1 58,157,840 (GRCm39) missense probably damaging 0.99
R6810:Aox3 UTSW 1 58,180,590 (GRCm39) missense probably benign 0.00
R6821:Aox3 UTSW 1 58,189,547 (GRCm39) missense probably benign 0.04
R7039:Aox3 UTSW 1 58,215,714 (GRCm39) missense probably damaging 1.00
R7116:Aox3 UTSW 1 58,192,689 (GRCm39) missense probably benign 0.01
R7146:Aox3 UTSW 1 58,197,688 (GRCm39) splice site probably null
R7163:Aox3 UTSW 1 58,158,671 (GRCm39) missense probably damaging 0.99
R7243:Aox3 UTSW 1 58,177,466 (GRCm39) missense unknown
R7319:Aox3 UTSW 1 58,191,761 (GRCm39) missense probably benign 0.04
R7423:Aox3 UTSW 1 58,160,228 (GRCm39) missense possibly damaging 0.80
R7664:Aox3 UTSW 1 58,158,698 (GRCm39) missense probably damaging 1.00
R7709:Aox3 UTSW 1 58,219,810 (GRCm39) missense probably damaging 1.00
R7745:Aox3 UTSW 1 58,215,676 (GRCm39) missense possibly damaging 0.75
R7751:Aox3 UTSW 1 58,218,494 (GRCm39) missense probably benign 0.11
R7912:Aox3 UTSW 1 58,181,855 (GRCm39) missense probably benign 0.05
R7940:Aox3 UTSW 1 58,227,596 (GRCm39) missense probably damaging 1.00
R8143:Aox3 UTSW 1 58,198,074 (GRCm39) missense probably benign 0.05
R8178:Aox3 UTSW 1 58,189,481 (GRCm39) missense possibly damaging 0.64
R8719:Aox3 UTSW 1 58,158,696 (GRCm39) missense probably damaging 1.00
R8861:Aox3 UTSW 1 58,189,460 (GRCm39) missense probably benign
R9379:Aox3 UTSW 1 58,208,959 (GRCm39) missense possibly damaging 0.77
R9472:Aox3 UTSW 1 58,215,669 (GRCm39) missense possibly damaging 0.47
R9479:Aox3 UTSW 1 58,177,568 (GRCm39) missense probably benign 0.23
R9521:Aox3 UTSW 1 58,164,222 (GRCm39) missense probably benign 0.10
R9750:Aox3 UTSW 1 58,215,648 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAGTAGCAATGGTCTAAGCC -3'
(R):5'- ATTCTATGCTTCTCTATGCCAAAGC -3'

Sequencing Primer
(F):5'- AGTACACTGTAGCTGTCTTCAGAC -3'
(R):5'- ATGCTTCTCTATGCCAAAGCTAATTC -3'
Posted On 2022-06-15