Incidental Mutation 'R9459:Serpinb8'
ID 714736
Institutional Source Beutler Lab
Gene Symbol Serpinb8
Ensembl Gene ENSMUSG00000026315
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms CAP2, Spi8, CAP-2, NK10, ovalbumin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9459 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 107590006-107610484 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 107605790 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 192 (K192*)
Ref Sequence ENSEMBL: ENSMUSP00000000514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000514] [ENSMUST00000112706] [ENSMUST00000123086]
AlphaFold O08800
Predicted Effect probably null
Transcript: ENSMUST00000000514
AA Change: K192*
SMART Domains Protein: ENSMUSP00000000514
Gene: ENSMUSG00000026315
AA Change: K192*

DomainStartEndE-ValueType
SERPIN 13 374 1.69e-177 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112706
AA Change: K192*
SMART Domains Protein: ENSMUSP00000108326
Gene: ENSMUSG00000026315
AA Change: K192*

DomainStartEndE-ValueType
SERPIN 13 374 1.69e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123086
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,729 H8L probably benign Het
Abcb1a T A 5: 8,685,414 probably null Het
Alms1 T A 6: 85,627,964 C2199S probably damaging Het
Aox3 A G 1: 58,150,309 I390V probably benign Het
Ap3b2 T C 7: 81,473,903 N400S probably benign Het
Baalc A T 15: 38,934,024 N70I probably benign Het
Brca2 T A 5: 150,540,629 V1286D probably damaging Het
Ccdc30 T C 4: 119,377,273 R81G possibly damaging Het
Cd209g T C 8: 4,135,610 S15P probably benign Het
Chrnb3 G A 8: 27,393,856 W207* probably null Het
Cmpk2 C T 12: 26,478,023 T413M probably damaging Het
Coq4 T A 2: 29,788,550 Y63N probably damaging Het
Depdc5 T A 5: 32,990,773 S1478T probably damaging Het
Etf1 A G 18: 34,906,081 F378L probably benign Het
Exoc6 T C 19: 37,585,893 V324A probably benign Het
Frem2 A G 3: 53,653,486 L1200P probably benign Het
Gadl1 T C 9: 115,965,611 W285R probably damaging Het
Gbp3 A G 3: 142,564,946 probably null Het
Gm14295 C T 2: 176,807,372 T5I possibly damaging Het
Hps4 T C 5: 112,375,009 S578P probably benign Het
Kctd13 T A 7: 126,945,082 D317E probably damaging Het
Kdm4b T A 17: 56,399,509 D881E probably benign Het
Klf10 G A 15: 38,295,927 P473L probably damaging Het
Lrch3 A T 16: 32,979,405 D371V probably damaging Het
Msh2 T C 17: 87,678,330 S112P possibly damaging Het
Msh3 A G 13: 92,215,539 V1036A possibly damaging Het
Mybl1 A G 1: 9,676,259 V392A possibly damaging Het
Myo7a T C 7: 98,073,173 I1182V possibly damaging Het
Nectin1 A C 9: 43,803,793 E442A probably benign Het
Obsl1 G T 1: 75,498,240 H839N probably benign Het
Olfr1202 T C 2: 88,817,623 F151L probably benign Het
Olfr1505 T C 19: 13,919,310 C97R possibly damaging Het
Pacs1 C T 19: 5,145,070 probably null Het
Pcdh17 G T 14: 84,448,623 E843D probably benign Het
Pcnt A G 10: 76,392,738 L1531P probably damaging Het
Pdgfra A G 5: 75,192,468 D973G probably damaging Het
Pkd2 A G 5: 104,466,934 Y214C probably damaging Het
Plcb1 T C 2: 135,322,638 Y427H probably benign Het
Ppm1h A G 10: 122,907,577 N402S possibly damaging Het
Rassf4 T A 6: 116,641,788 probably null Het
Ryr1 G A 7: 29,068,643 T2856I probably damaging Het
Slfn14 T G 11: 83,279,372 Q482P possibly damaging Het
Spata2 A G 2: 167,485,285 V64A probably benign Het
Tax1bp1 T G 6: 52,729,329 V105G probably damaging Het
Tbc1d22a T G 15: 86,235,820 S142A possibly damaging Het
Tdrd9 T C 12: 112,025,573 F594S probably damaging Het
Uba3 T C 6: 97,189,598 I281V probably benign Het
Uggt2 T C 14: 119,049,183 E723G probably benign Het
Usp20 C T 2: 31,011,012 S391F probably damaging Het
Usp24 T A 4: 106,342,358 D166E probably damaging Het
Vmn1r1 A G 1: 182,157,938 V54A probably benign Het
Zfp442 T A 2: 150,408,748 E411D unknown Het
Zfp804a T C 2: 82,259,409 I1194T probably damaging Het
Other mutations in Serpinb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Serpinb8 APN 1 107606984 missense probably benign 0.01
IGL01309:Serpinb8 APN 1 107604718 missense probably damaging 1.00
IGL03210:Serpinb8 APN 1 107602911 missense probably damaging 1.00
Hachi UTSW 1 107597471 start codon destroyed probably null 1.00
BB002:Serpinb8 UTSW 1 107598985 missense probably benign 0.25
BB012:Serpinb8 UTSW 1 107598985 missense probably benign 0.25
IGL02835:Serpinb8 UTSW 1 107602856 missense probably damaging 1.00
R0284:Serpinb8 UTSW 1 107602918 critical splice donor site probably null
R1087:Serpinb8 UTSW 1 107606997 missense probably damaging 0.99
R1728:Serpinb8 UTSW 1 107597527 missense probably benign
R1728:Serpinb8 UTSW 1 107598954 missense probably benign
R1728:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1729:Serpinb8 UTSW 1 107597527 missense probably benign
R1729:Serpinb8 UTSW 1 107598954 missense probably benign
R1729:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1730:Serpinb8 UTSW 1 107597527 missense probably benign
R1730:Serpinb8 UTSW 1 107598954 missense probably benign
R1730:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1739:Serpinb8 UTSW 1 107597527 missense probably benign
R1739:Serpinb8 UTSW 1 107598954 missense probably benign
R1739:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1762:Serpinb8 UTSW 1 107597527 missense probably benign
R1762:Serpinb8 UTSW 1 107598954 missense probably benign
R1762:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1783:Serpinb8 UTSW 1 107597527 missense probably benign
R1783:Serpinb8 UTSW 1 107598954 missense probably benign
R1783:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1785:Serpinb8 UTSW 1 107597527 missense probably benign
R1785:Serpinb8 UTSW 1 107598954 missense probably benign
R1785:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R2120:Serpinb8 UTSW 1 107605887 missense probably damaging 1.00
R2146:Serpinb8 UTSW 1 107605927 missense probably benign 0.11
R2148:Serpinb8 UTSW 1 107605927 missense probably benign 0.11
R2391:Serpinb8 UTSW 1 107607069 missense probably damaging 1.00
R2897:Serpinb8 UTSW 1 107607046 missense unknown
R2898:Serpinb8 UTSW 1 107607046 missense unknown
R3114:Serpinb8 UTSW 1 107607293 missense probably benign 0.09
R3697:Serpinb8 UTSW 1 107607146 nonsense probably null
R4783:Serpinb8 UTSW 1 107604742 missense probably benign 0.05
R5225:Serpinb8 UTSW 1 107597471 start codon destroyed probably null 1.00
R5412:Serpinb8 UTSW 1 107605886 missense probably benign 0.39
R5525:Serpinb8 UTSW 1 107607293 missense probably damaging 0.99
R5554:Serpinb8 UTSW 1 107598975 missense probably benign 0.01
R5891:Serpinb8 UTSW 1 107605845 missense probably damaging 0.98
R6594:Serpinb8 UTSW 1 107597471 start codon destroyed probably null 1.00
R6681:Serpinb8 UTSW 1 107597591 missense probably damaging 1.00
R7127:Serpinb8 UTSW 1 107597470 start codon destroyed probably null 1.00
R7151:Serpinb8 UTSW 1 107605797 missense probably damaging 1.00
R7300:Serpinb8 UTSW 1 107607323 makesense probably null
R7716:Serpinb8 UTSW 1 107604708 nonsense probably null
R7807:Serpinb8 UTSW 1 107604727 missense probably damaging 1.00
R7822:Serpinb8 UTSW 1 107606993 nonsense probably null
R7925:Serpinb8 UTSW 1 107598985 missense probably benign 0.25
R8210:Serpinb8 UTSW 1 107599006 missense probably damaging 1.00
R9046:Serpinb8 UTSW 1 107602833 missense possibly damaging 0.89
R9303:Serpinb8 UTSW 1 107599039 critical splice donor site probably null
R9305:Serpinb8 UTSW 1 107599039 critical splice donor site probably null
X0018:Serpinb8 UTSW 1 107597597 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTTGGAAGTGCTTCACTATGAG -3'
(R):5'- GTTTCCATAGACTCTCAGCGC -3'

Sequencing Primer
(F):5'- TCTATTCTACTAATACTGCAATGTGC -3'
(R):5'- ATAGACTCTCAGCGCCCAGG -3'
Posted On 2022-06-15