Mutagenetix > Incidental Mutation

Incidental Mutation 'R9459:Serpinb8'

714736

Institutional Source

Beutler Lab

Gene Symbol

Serpinb8

Ensembl Gene

ENSMUSG00000026315

Gene Name

serine (or cysteine) peptidase inhibitor, clade B, member 8

Synonyms

CAP2, Spi8, CAP-2, NK10, ovalbumin

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R9459 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107590006-107610484 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 107605790 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 192 (K192*)

Ref Sequence

ENSEMBL: ENSMUSP00000000514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000514] [ENSMUST00000112706] [ENSMUST00000123086]

AlphaFold

O08800

Predicted Effect

probably null
Transcript: ENSMUST00000000514
AA Change: K192*

SMART Domains

Protein: ENSMUSP00000000514
Gene: ENSMUSG00000026315
AA Change: K192*

Domain	Start	End	E-Value	Type
SERPIN	13	374	1.69e-177	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112706
AA Change: K192*

SMART Domains

Protein: ENSMUSP00000108326
Gene: ENSMUSG00000026315
AA Change: K192*

Domain	Start	End	E-Value	Type
SERPIN	13	374	1.69e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123086

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	T	A	19: 5,503,729	H8L	probably benign	Het
Abcb1a	T	A	5: 8,685,414		probably null	Het
Alms1	T	A	6: 85,627,964	C2199S	probably damaging	Het
Aox3	A	G	1: 58,150,309	I390V	probably benign	Het
Ap3b2	T	C	7: 81,473,903	N400S	probably benign	Het
Baalc	A	T	15: 38,934,024	N70I	probably benign	Het
Brca2	T	A	5: 150,540,629	V1286D	probably damaging	Het
Ccdc30	T	C	4: 119,377,273	R81G	possibly damaging	Het
Cd209g	T	C	8: 4,135,610	S15P	probably benign	Het
Chrnb3	G	A	8: 27,393,856	W207*	probably null	Het
Cmpk2	C	T	12: 26,478,023	T413M	probably damaging	Het
Coq4	T	A	2: 29,788,550	Y63N	probably damaging	Het
Depdc5	T	A	5: 32,990,773	S1478T	probably damaging	Het
Etf1	A	G	18: 34,906,081	F378L	probably benign	Het
Exoc6	T	C	19: 37,585,893	V324A	probably benign	Het
Frem2	A	G	3: 53,653,486	L1200P	probably benign	Het
Gadl1	T	C	9: 115,965,611	W285R	probably damaging	Het
Gbp3	A	G	3: 142,564,946		probably null	Het
Gm14295	C	T	2: 176,807,372	T5I	possibly damaging	Het
Hps4	T	C	5: 112,375,009	S578P	probably benign	Het
Kctd13	T	A	7: 126,945,082	D317E	probably damaging	Het
Kdm4b	T	A	17: 56,399,509	D881E	probably benign	Het
Klf10	G	A	15: 38,295,927	P473L	probably damaging	Het
Lrch3	A	T	16: 32,979,405	D371V	probably damaging	Het
Msh2	T	C	17: 87,678,330	S112P	possibly damaging	Het
Msh3	A	G	13: 92,215,539	V1036A	possibly damaging	Het
Mybl1	A	G	1: 9,676,259	V392A	possibly damaging	Het
Myo7a	T	C	7: 98,073,173	I1182V	possibly damaging	Het
Nectin1	A	C	9: 43,803,793	E442A	probably benign	Het
Obsl1	G	T	1: 75,498,240	H839N	probably benign	Het
Olfr1202	T	C	2: 88,817,623	F151L	probably benign	Het
Olfr1505	T	C	19: 13,919,310	C97R	possibly damaging	Het
Pacs1	C	T	19: 5,145,070		probably null	Het
Pcdh17	G	T	14: 84,448,623	E843D	probably benign	Het
Pcnt	A	G	10: 76,392,738	L1531P	probably damaging	Het
Pdgfra	A	G	5: 75,192,468	D973G	probably damaging	Het
Pkd2	A	G	5: 104,466,934	Y214C	probably damaging	Het
Plcb1	T	C	2: 135,322,638	Y427H	probably benign	Het
Ppm1h	A	G	10: 122,907,577	N402S	possibly damaging	Het
Rassf4	T	A	6: 116,641,788		probably null	Het
Ryr1	G	A	7: 29,068,643	T2856I	probably damaging	Het
Slfn14	T	G	11: 83,279,372	Q482P	possibly damaging	Het
Spata2	A	G	2: 167,485,285	V64A	probably benign	Het
Tax1bp1	T	G	6: 52,729,329	V105G	probably damaging	Het
Tbc1d22a	T	G	15: 86,235,820	S142A	possibly damaging	Het
Tdrd9	T	C	12: 112,025,573	F594S	probably damaging	Het
Uba3	T	C	6: 97,189,598	I281V	probably benign	Het
Uggt2	T	C	14: 119,049,183	E723G	probably benign	Het
Usp20	C	T	2: 31,011,012	S391F	probably damaging	Het
Usp24	T	A	4: 106,342,358	D166E	probably damaging	Het
Vmn1r1	A	G	1: 182,157,938	V54A	probably benign	Het
Zfp442	T	A	2: 150,408,748	E411D	unknown	Het
Zfp804a	T	C	2: 82,259,409	I1194T	probably damaging	Het

Other mutations in Serpinb8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Serpinb8	APN	1	107606984	missense	probably benign	0.01
IGL01309:Serpinb8	APN	1	107604718	missense	probably damaging	1.00
IGL03210:Serpinb8	APN	1	107602911	missense	probably damaging	1.00
Hachi	UTSW	1	107597471	start codon destroyed	probably null	1.00
BB002:Serpinb8	UTSW	1	107598985	missense	probably benign	0.25
BB012:Serpinb8	UTSW	1	107598985	missense	probably benign	0.25
IGL02835:Serpinb8	UTSW	1	107602856	missense	probably damaging	1.00
R0284:Serpinb8	UTSW	1	107602918	critical splice donor site	probably null
R1087:Serpinb8	UTSW	1	107606997	missense	probably damaging	0.99
R1728:Serpinb8	UTSW	1	107597527	missense	probably benign
R1728:Serpinb8	UTSW	1	107598954	missense	probably benign
R1728:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1729:Serpinb8	UTSW	1	107597527	missense	probably benign
R1729:Serpinb8	UTSW	1	107598954	missense	probably benign
R1729:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1730:Serpinb8	UTSW	1	107597527	missense	probably benign
R1730:Serpinb8	UTSW	1	107598954	missense	probably benign
R1730:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1739:Serpinb8	UTSW	1	107597527	missense	probably benign
R1739:Serpinb8	UTSW	1	107598954	missense	probably benign
R1739:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1762:Serpinb8	UTSW	1	107597527	missense	probably benign
R1762:Serpinb8	UTSW	1	107598954	missense	probably benign
R1762:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1783:Serpinb8	UTSW	1	107597527	missense	probably benign
R1783:Serpinb8	UTSW	1	107598954	missense	probably benign
R1783:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R1785:Serpinb8	UTSW	1	107597527	missense	probably benign
R1785:Serpinb8	UTSW	1	107598954	missense	probably benign
R1785:Serpinb8	UTSW	1	107607004	missense	probably benign	0.02
R2120:Serpinb8	UTSW	1	107605887	missense	probably damaging	1.00
R2146:Serpinb8	UTSW	1	107605927	missense	probably benign	0.11
R2148:Serpinb8	UTSW	1	107605927	missense	probably benign	0.11
R2391:Serpinb8	UTSW	1	107607069	missense	probably damaging	1.00
R2897:Serpinb8	UTSW	1	107607046	missense	unknown
R2898:Serpinb8	UTSW	1	107607046	missense	unknown
R3114:Serpinb8	UTSW	1	107607293	missense	probably benign	0.09
R3697:Serpinb8	UTSW	1	107607146	nonsense	probably null
R4783:Serpinb8	UTSW	1	107604742	missense	probably benign	0.05
R5225:Serpinb8	UTSW	1	107597471	start codon destroyed	probably null	1.00
R5412:Serpinb8	UTSW	1	107605886	missense	probably benign	0.39
R5525:Serpinb8	UTSW	1	107607293	missense	probably damaging	0.99
R5554:Serpinb8	UTSW	1	107598975	missense	probably benign	0.01
R5891:Serpinb8	UTSW	1	107605845	missense	probably damaging	0.98
R6594:Serpinb8	UTSW	1	107597471	start codon destroyed	probably null	1.00
R6681:Serpinb8	UTSW	1	107597591	missense	probably damaging	1.00
R7127:Serpinb8	UTSW	1	107597470	start codon destroyed	probably null	1.00
R7151:Serpinb8	UTSW	1	107605797	missense	probably damaging	1.00
R7300:Serpinb8	UTSW	1	107607323	makesense	probably null
R7716:Serpinb8	UTSW	1	107604708	nonsense	probably null
R7807:Serpinb8	UTSW	1	107604727	missense	probably damaging	1.00
R7822:Serpinb8	UTSW	1	107606993	nonsense	probably null
R7925:Serpinb8	UTSW	1	107598985	missense	probably benign	0.25
R8210:Serpinb8	UTSW	1	107599006	missense	probably damaging	1.00
R9046:Serpinb8	UTSW	1	107602833	missense	possibly damaging	0.89
R9303:Serpinb8	UTSW	1	107599039	critical splice donor site	probably null
R9305:Serpinb8	UTSW	1	107599039	critical splice donor site	probably null
X0018:Serpinb8	UTSW	1	107597597	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCTTGGAAGTGCTTCACTATGAG -3'
(R):5'- GTTTCCATAGACTCTCAGCGC -3'

Sequencing Primer
(F):5'- TCTATTCTACTAATACTGCAATGTGC -3'
(R):5'- ATAGACTCTCAGCGCCCAGG -3'

Posted On

2022-06-15